Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641240_a_at:

>probe:Drosophila_2:1641240_a_at:520:711; Interrogation_Position=1028; Antisense; TTCAAGGGCATTCTATGGCGCGGTT
>probe:Drosophila_2:1641240_a_at:78:581; Interrogation_Position=1043; Antisense; TGGCGCGGTTTCTTAAATGGACCCA
>probe:Drosophila_2:1641240_a_at:113:27; Interrogation_Position=1082; Antisense; ATAGTTCGCATGATGGTTCGTCCAC
>probe:Drosophila_2:1641240_a_at:541:627; Interrogation_Position=1102; Antisense; TCCACGCGCCGCTTTATAAATAAGT
>probe:Drosophila_2:1641240_a_at:534:665; Interrogation_Position=641; Antisense; TACAAGATCGGTTTCGGGCCACTAA
>probe:Drosophila_2:1641240_a_at:8:661; Interrogation_Position=663; Antisense; TAACCACCGAGTTCTTCATCGGATT
>probe:Drosophila_2:1641240_a_at:98:57; Interrogation_Position=723; Antisense; ATGAGCTTTTGGTTCAGCTGCAGAA
>probe:Drosophila_2:1641240_a_at:499:349; Interrogation_Position=754; Antisense; GCAGGAGCTGAGATATGCCCTATAT
>probe:Drosophila_2:1641240_a_at:223:25; Interrogation_Position=775; Antisense; ATATGATCACTTTAGCATCGGCAGT
>probe:Drosophila_2:1641240_a_at:520:461; Interrogation_Position=833; Antisense; GATTATCACGGCGATGCTGCCGATG
>probe:Drosophila_2:1641240_a_at:698:443; Interrogation_Position=854; Antisense; GATGCATTGCGTGACCACACGGGAA
>probe:Drosophila_2:1641240_a_at:173:281; Interrogation_Position=933; Antisense; CTCAGCAGTCGGGAGCTTTTTGGTA
>probe:Drosophila_2:1641240_a_at:231:591; Interrogation_Position=953; Antisense; TGGTATGGCGGCTCTTGCAATCTCA
>probe:Drosophila_2:1641240_a_at:496:581; Interrogation_Position=988; Antisense; TGGCCTATATCAACGCCTTCTAGAA

Paste this into a BLAST search page for me
TTCAAGGGCATTCTATGGCGCGGTTTGGCGCGGTTTCTTAAATGGACCCAATAGTTCGCATGATGGTTCGTCCACTCCACGCGCCGCTTTATAAATAAGTTACAAGATCGGTTTCGGGCCACTAATAACCACCGAGTTCTTCATCGGATTATGAGCTTTTGGTTCAGCTGCAGAAGCAGGAGCTGAGATATGCCCTATATATATGATCACTTTAGCATCGGCAGTGATTATCACGGCGATGCTGCCGATGGATGCATTGCGTGACCACACGGGAACTCAGCAGTCGGGAGCTTTTTGGTATGGTATGGCGGCTCTTGCAATCTCATGGCCTATATCAACGCCTTCTAGAA

Full Affymetrix probeset data:

Annotations for 1641240_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime