Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641241_at:

>probe:Drosophila_2:1641241_at:407:467; Interrogation_Position=1012; Antisense; GTTGGATTCAGAACTCGTCGATCAA
>probe:Drosophila_2:1641241_at:73:637; Interrogation_Position=1029; Antisense; TCGATCAACTTCTCAAGCGGCTTAG
>probe:Drosophila_2:1641241_at:44:371; Interrogation_Position=1077; Antisense; GAATGTACAGTTCCAGGGACACCGA
>probe:Drosophila_2:1641241_at:335:705; Interrogation_Position=603; Antisense; TTATCCATGCCGACATTAAGCCTGG
>probe:Drosophila_2:1641241_at:195:185; Interrogation_Position=659; Antisense; AAAATAGCTGATCTTGGCGTATGCA
>probe:Drosophila_2:1641241_at:313:383; Interrogation_Position=732; Antisense; GAACTCCAGCTTTCAGGGCTCCTGA
>probe:Drosophila_2:1641241_at:606:283; Interrogation_Position=753; Antisense; CTGAAACTCTTATCCCTGGACAGGA
>probe:Drosophila_2:1641241_at:445:719; Interrogation_Position=818; Antisense; TTGAAAGGTTCATACGCGCAGGTCG
>probe:Drosophila_2:1641241_at:140:135; Interrogation_Position=831; Antisense; ACGCGCAGGTCGATCTAATTCAGCA
>probe:Drosophila_2:1641241_at:54:649; Interrogation_Position=850; Antisense; TCAGCACCTGGTTCATATCATATGT
>probe:Drosophila_2:1641241_at:713:369; Interrogation_Position=894; Antisense; GAATGGAGCTTCTCCTGACTGACAG
>probe:Drosophila_2:1641241_at:234:725; Interrogation_Position=932; Antisense; TTGATCCTCGTCCAAGAAGGTCCGG
>probe:Drosophila_2:1641241_at:445:109; Interrogation_Position=946; Antisense; AGAAGGTCCGGATTGCCGCCAGCAA
>probe:Drosophila_2:1641241_at:687:619; Interrogation_Position=973; Antisense; TGCTCTGTTGCTCTGCAGTGAGTAT

Paste this into a BLAST search page for me
GTTGGATTCAGAACTCGTCGATCAATCGATCAACTTCTCAAGCGGCTTAGGAATGTACAGTTCCAGGGACACCGATTATCCATGCCGACATTAAGCCTGGAAAATAGCTGATCTTGGCGTATGCAGAACTCCAGCTTTCAGGGCTCCTGACTGAAACTCTTATCCCTGGACAGGATTGAAAGGTTCATACGCGCAGGTCGACGCGCAGGTCGATCTAATTCAGCATCAGCACCTGGTTCATATCATATGTGAATGGAGCTTCTCCTGACTGACAGTTGATCCTCGTCCAAGAAGGTCCGGAGAAGGTCCGGATTGCCGCCAGCAATGCTCTGTTGCTCTGCAGTGAGTAT

Full Affymetrix probeset data:

Annotations for 1641241_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime