FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641242_at:

>probe:Drosophila_2:1641242_at:388:365; Interrogation_Position=1014; Antisense; GAATGTCTACATTTCCGACTGGTTT
>probe:Drosophila_2:1641242_at:180:407; Interrogation_Position=1030; Antisense; GACTGGTTTCCACAGACGGACATAT
>probe:Drosophila_2:1641242_at:671:19; Interrogation_Position=1051; Antisense; ATATTGGCCCATCCCAAGATCATGG
>probe:Drosophila_2:1641242_at:392:453; Interrogation_Position=1068; Antisense; GATCATGGCATTTGTGACCCACGGC
>probe:Drosophila_2:1641242_at:657:259; Interrogation_Position=1107; Antisense; CACGGAGTCCATTTATCATGCTAAA
>probe:Drosophila_2:1641242_at:172:41; Interrogation_Position=1138; Antisense; ATCGGTTTGCCGATCTTTAGTGATC
>probe:Drosophila_2:1641242_at:534:477; Interrogation_Position=1164; Antisense; GTTTTTCAACATGGCTCATGCCGAG
>probe:Drosophila_2:1641242_at:355:233; Interrogation_Position=1206; Antisense; AATGCTGGACTTCAAGACGCTGAAT
>probe:Drosophila_2:1641242_at:174:221; Interrogation_Position=1266; Antisense; AAGTGAGCCATCCTACACCAAAGTG
>probe:Drosophila_2:1641242_at:294:83; Interrogation_Position=1295; Antisense; AGGGCATATCCTTCCGATATCGGGA
>probe:Drosophila_2:1641242_at:335:639; Interrogation_Position=1314; Antisense; TCGGGATCAACAACAAACGCCAATT
>probe:Drosophila_2:1641242_at:430:585; Interrogation_Position=1358; Antisense; TGGAACATGTGACCCGCCATCAAGG
>probe:Drosophila_2:1641242_at:614:541; Interrogation_Position=1470; Antisense; GGTTCTGTTGCTAATTGTACTGCCA
>probe:Drosophila_2:1641242_at:115:725; Interrogation_Position=983; Antisense; TTGAGCTGGATAACCTGCCCAACAA

Paste this into a BLAST search page for me
GAATGTCTACATTTCCGACTGGTTTGACTGGTTTCCACAGACGGACATATATATTGGCCCATCCCAAGATCATGGGATCATGGCATTTGTGACCCACGGCCACGGAGTCCATTTATCATGCTAAAATCGGTTTGCCGATCTTTAGTGATCGTTTTTCAACATGGCTCATGCCGAGAATGCTGGACTTCAAGACGCTGAATAAGTGAGCCATCCTACACCAAAGTGAGGGCATATCCTTCCGATATCGGGATCGGGATCAACAACAAACGCCAATTTGGAACATGTGACCCGCCATCAAGGGGTTCTGTTGCTAATTGTACTGCCATTGAGCTGGATAACCTGCCCAACAA

Full Affymetrix probeset data:

Annotations for 1641242_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720