FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641243_at:

>probe:Drosophila_2:1641243_at:685:83; Interrogation_Position=110; Antisense; AGTGTGGGAAATCGACACGAATTTC
>probe:Drosophila_2:1641243_at:566:165; Interrogation_Position=118; Antisense; AAATCGACACGAATTTCCACAAATA
>probe:Drosophila_2:1641243_at:605:243; Interrogation_Position=129; Antisense; AATTTCCACAAATATGCGCCGGCAA
>probe:Drosophila_2:1641243_at:693:63; Interrogation_Position=13; Antisense; ATGTGGCTCATTTGTTGCTGCCCCG
>probe:Drosophila_2:1641243_at:365:681; Interrogation_Position=141; Antisense; TATGCGCCGGCAAATAGAAACGTCG
>probe:Drosophila_2:1641243_at:692:301; Interrogation_Position=146; Antisense; GCCGGCAAATAGAAACGTCGGACGT
>probe:Drosophila_2:1641243_at:606:139; Interrogation_Position=160; Antisense; ACGTCGGACGTTATAATGAGCCATA
>probe:Drosophila_2:1641243_at:441:651; Interrogation_Position=173; Antisense; TAATGAGCCATATCAGCGGACAAAT
>probe:Drosophila_2:1641243_at:650:329; Interrogation_Position=188; Antisense; GCGGACAAATATTACCCACTGGAAT
>probe:Drosophila_2:1641243_at:146:279; Interrogation_Position=19; Antisense; CTCATTTGTTGCTGCCCCGTGTTTT
>probe:Drosophila_2:1641243_at:209:65; Interrogation_Position=218; Antisense; ATGGGAAAAACAATGAGCAGCCTCA
>probe:Drosophila_2:1641243_at:290:609; Interrogation_Position=231; Antisense; TGAGCAGCCTCATCATCACGATCAT
>probe:Drosophila_2:1641243_at:674:533; Interrogation_Position=82; Antisense; GGTGTCACAGCAAATCAGTGTCAAT
>probe:Drosophila_2:1641243_at:312:23; Interrogation_Position=95; Antisense; ATCAGTGTCAATCAAAGTGTGGGAA

Paste this into a BLAST search page for me
AGTGTGGGAAATCGACACGAATTTCAAATCGACACGAATTTCCACAAATAAATTTCCACAAATATGCGCCGGCAAATGTGGCTCATTTGTTGCTGCCCCGTATGCGCCGGCAAATAGAAACGTCGGCCGGCAAATAGAAACGTCGGACGTACGTCGGACGTTATAATGAGCCATATAATGAGCCATATCAGCGGACAAATGCGGACAAATATTACCCACTGGAATCTCATTTGTTGCTGCCCCGTGTTTTATGGGAAAAACAATGAGCAGCCTCATGAGCAGCCTCATCATCACGATCATGGTGTCACAGCAAATCAGTGTCAATATCAGTGTCAATCAAAGTGTGGGAA

Full Affymetrix probeset data:

Annotations for 1641243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720