FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641244_at:

>probe:Drosophila_2:1641244_at:568:217; Interrogation_Position=2959; Antisense; AAGTTTACAACCGAGCAGCAATCCT
>probe:Drosophila_2:1641244_at:576:495; Interrogation_Position=3018; Antisense; GTCTGGAGGAAAGGCCACTCCGGCA
>probe:Drosophila_2:1641244_at:467:297; Interrogation_Position=3045; Antisense; CGCACAGGCGGAACCGGAACGCTAT
>probe:Drosophila_2:1641244_at:44:563; Interrogation_Position=3060; Antisense; GGAACGCTATGGCATCCACTTCGAT
>probe:Drosophila_2:1641244_at:560:463; Interrogation_Position=3111; Antisense; GTTCTTCCTGTGCAACCTGGTGGGC
>probe:Drosophila_2:1641244_at:603:445; Interrogation_Position=3149; Antisense; GATCCTTGCACTATCAGTTCTACGT
>probe:Drosophila_2:1641244_at:49:35; Interrogation_Position=3161; Antisense; ATCAGTTCTACGTCTGGTACTTCCA
>probe:Drosophila_2:1641244_at:47:605; Interrogation_Position=3196; Antisense; TATTTGGCCTGGTCGACGCCGTACT
>probe:Drosophila_2:1641244_at:400:315; Interrogation_Position=3236; Antisense; GCCTGATCCTCGGACTGATTGAGTA
>probe:Drosophila_2:1641244_at:300:465; Interrogation_Position=3252; Antisense; GATTGAGTACTGCTGGAACACCTAT
>probe:Drosophila_2:1641244_at:274:585; Interrogation_Position=3265; Antisense; TGGAACACCTATCCCAGTACGAACT
>probe:Drosophila_2:1641244_at:8:117; Interrogation_Position=3347; Antisense; AGCTTGTCCAGACCATGCGGATTAA
>probe:Drosophila_2:1641244_at:330:641; Interrogation_Position=3426; Antisense; TCTGAGTGCCACTTGTTAGCCATGA
>probe:Drosophila_2:1641244_at:553:429; Interrogation_Position=3449; Antisense; GAGTGCCACATATAAACCGTTTTGA

Paste this into a BLAST search page for me
AAGTTTACAACCGAGCAGCAATCCTGTCTGGAGGAAAGGCCACTCCGGCACGCACAGGCGGAACCGGAACGCTATGGAACGCTATGGCATCCACTTCGATGTTCTTCCTGTGCAACCTGGTGGGCGATCCTTGCACTATCAGTTCTACGTATCAGTTCTACGTCTGGTACTTCCATATTTGGCCTGGTCGACGCCGTACTGCCTGATCCTCGGACTGATTGAGTAGATTGAGTACTGCTGGAACACCTATTGGAACACCTATCCCAGTACGAACTAGCTTGTCCAGACCATGCGGATTAATCTGAGTGCCACTTGTTAGCCATGAGAGTGCCACATATAAACCGTTTTGA

Full Affymetrix probeset data:

Annotations for 1641244_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720