FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641246_at:

>probe:Drosophila_2:1641246_at:19:721; Interrogation_Position=2642; Antisense; TTCCAGATTCTGCAGTCCACACAGA
>probe:Drosophila_2:1641246_at:88:209; Interrogation_Position=2669; Antisense; AAGCTATCGGTGAGTCCGCAGCCAA
>probe:Drosophila_2:1641246_at:227:511; Interrogation_Position=2711; Antisense; GTGAATGTCCAGTCGGGCAGTAATC
>probe:Drosophila_2:1641246_at:500:533; Interrogation_Position=2753; Antisense; GGTGTCCTGCAGCACTTTAGCAAGC
>probe:Drosophila_2:1641246_at:149:377; Interrogation_Position=2779; Antisense; GAAGAAACACTTCCGTCGCGTGGAG
>probe:Drosophila_2:1641246_at:432:329; Interrogation_Position=2796; Antisense; GCGTGGAGTCCGTTCAATTAAGCCT
>probe:Drosophila_2:1641246_at:706:245; Interrogation_Position=2811; Antisense; AATTAAGCCTCACCTCACAGCTAAT
>probe:Drosophila_2:1641246_at:401:115; Interrogation_Position=2871; Antisense; AGCAGGGCGCCAACGATACTGTGAC
>probe:Drosophila_2:1641246_at:214:29; Interrogation_Position=2886; Antisense; ATACTGTGACCCTCAATCAGATTGT
>probe:Drosophila_2:1641246_at:658:33; Interrogation_Position=2901; Antisense; ATCAGATTGTAAAGCCCCAGCGCGA
>probe:Drosophila_2:1641246_at:670:227; Interrogation_Position=2960; Antisense; AATGGCGGGCACTTCCAGGTGACGC
>probe:Drosophila_2:1641246_at:455:369; Interrogation_Position=3007; Antisense; GAATGGCATTACCTGGTGCACTGGC
>probe:Drosophila_2:1641246_at:580:577; Interrogation_Position=3028; Antisense; TGGCCCCAAATCCTCGATGGTGGTG
>probe:Drosophila_2:1641246_at:498:435; Interrogation_Position=3062; Antisense; GAGGATCCTAGCAAGCAGGGCGCTC

Paste this into a BLAST search page for me
TTCCAGATTCTGCAGTCCACACAGAAAGCTATCGGTGAGTCCGCAGCCAAGTGAATGTCCAGTCGGGCAGTAATCGGTGTCCTGCAGCACTTTAGCAAGCGAAGAAACACTTCCGTCGCGTGGAGGCGTGGAGTCCGTTCAATTAAGCCTAATTAAGCCTCACCTCACAGCTAATAGCAGGGCGCCAACGATACTGTGACATACTGTGACCCTCAATCAGATTGTATCAGATTGTAAAGCCCCAGCGCGAAATGGCGGGCACTTCCAGGTGACGCGAATGGCATTACCTGGTGCACTGGCTGGCCCCAAATCCTCGATGGTGGTGGAGGATCCTAGCAAGCAGGGCGCTC

Full Affymetrix probeset data:

Annotations for 1641246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720