Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641247_at:

>probe:Drosophila_2:1641247_at:127:65; Interrogation_Position=4716; Antisense; ATGGTGACTCGTGACTTGTTACTGC
>probe:Drosophila_2:1641247_at:427:291; Interrogation_Position=4725; Antisense; CGTGACTTGTTACTGCTTTGTTATT
>probe:Drosophila_2:1641247_at:341:41; Interrogation_Position=4797; Antisense; ATCGCTAGTTAGCAATACTCCGGCC
>probe:Drosophila_2:1641247_at:34:157; Interrogation_Position=4823; Antisense; ACAACCGTCAATCCGCAATCCTTAG
>probe:Drosophila_2:1641247_at:486:265; Interrogation_Position=4865; Antisense; CAGGTCCCAGGTGCTTCGCAGAGAC
>probe:Drosophila_2:1641247_at:312:351; Interrogation_Position=4882; Antisense; GCAGAGACGCCAGAAGACCATTTTA
>probe:Drosophila_2:1641247_at:194:231; Interrogation_Position=4932; Antisense; AATGAATTGTGCTTTCCTCGTTTTG
>probe:Drosophila_2:1641247_at:337:507; Interrogation_Position=4940; Antisense; GTGCTTTCCTCGTTTTGTATAGTTA
>probe:Drosophila_2:1641247_at:386:483; Interrogation_Position=4956; Antisense; GTATAGTTACCTATGCGCAGGCATA
>probe:Drosophila_2:1641247_at:226:669; Interrogation_Position=5034; Antisense; TACGCTTAGGTTTAGTTGATAGGCA
>probe:Drosophila_2:1641247_at:372:727; Interrogation_Position=5086; Antisense; TTGTATATGATCACACATCCCGCAC
>probe:Drosophila_2:1641247_at:672:297; Interrogation_Position=5106; Antisense; CGCACCGCGAATGCATCATGCATTA
>probe:Drosophila_2:1641247_at:144:687; Interrogation_Position=5145; Antisense; TATAGCCCAAAAACACACCAGGATA
>probe:Drosophila_2:1641247_at:584:165; Interrogation_Position=5186; Antisense; AAATCGAAGCGGTCGACCGTGCAAA

Paste this into a BLAST search page for me
ATGGTGACTCGTGACTTGTTACTGCCGTGACTTGTTACTGCTTTGTTATTATCGCTAGTTAGCAATACTCCGGCCACAACCGTCAATCCGCAATCCTTAGCAGGTCCCAGGTGCTTCGCAGAGACGCAGAGACGCCAGAAGACCATTTTAAATGAATTGTGCTTTCCTCGTTTTGGTGCTTTCCTCGTTTTGTATAGTTAGTATAGTTACCTATGCGCAGGCATATACGCTTAGGTTTAGTTGATAGGCATTGTATATGATCACACATCCCGCACCGCACCGCGAATGCATCATGCATTATATAGCCCAAAAACACACCAGGATAAAATCGAAGCGGTCGACCGTGCAAA

Full Affymetrix probeset data:

Annotations for 1641247_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime