FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641248_at:

>probe:Drosophila_2:1641248_at:458:279; Interrogation_Position=1441; Antisense; CTACGTACTCCTCGCTGGATATCTA
>probe:Drosophila_2:1641248_at:331:297; Interrogation_Position=1480; Antisense; CGCTGCAGGGCTTCTTCGAGACGAA
>probe:Drosophila_2:1641248_at:405:685; Interrogation_Position=1506; Antisense; TATCAGCACAGCGTGAACCTGCAGT
>probe:Drosophila_2:1641248_at:564:613; Interrogation_Position=1519; Antisense; TGAACCTGCAGTGCGTGGTGACCAT
>probe:Drosophila_2:1641248_at:146:47; Interrogation_Position=1542; Antisense; ATCCGGCACATGTACCACAAAGTCG
>probe:Drosophila_2:1641248_at:449:45; Interrogation_Position=1610; Antisense; ATCGCCGAATCTGCTGGGACTCGAG
>probe:Drosophila_2:1641248_at:455:635; Interrogation_Position=1630; Antisense; TCGAGGGATCCAAGCGGTATGCCAA
>probe:Drosophila_2:1641248_at:433:551; Interrogation_Position=1656; Antisense; GGAGATCCGGACAACTCGGCGCTGA
>probe:Drosophila_2:1641248_at:432:19; Interrogation_Position=1704; Antisense; ATTTGCTGTGGAGCCTTTGGCGCTG
>probe:Drosophila_2:1641248_at:346:479; Interrogation_Position=1728; Antisense; GTTTCGCTGGCGATTTTCACACTGG
>probe:Drosophila_2:1641248_at:111:69; Interrogation_Position=1755; Antisense; ATGGCGCATCTGTGACCGCAGCGGA
>probe:Drosophila_2:1641248_at:516:553; Interrogation_Position=1777; Antisense; GGACCGCTTAAATCCGCCATGGAAA
>probe:Drosophila_2:1641248_at:588:199; Interrogation_Position=1801; Antisense; AACGCAAATGCAGCCGGACAAGTCA
>probe:Drosophila_2:1641248_at:435:559; Interrogation_Position=1816; Antisense; GGACAAGTCACCTCCAAGGATGAAA

Paste this into a BLAST search page for me
CTACGTACTCCTCGCTGGATATCTACGCTGCAGGGCTTCTTCGAGACGAATATCAGCACAGCGTGAACCTGCAGTTGAACCTGCAGTGCGTGGTGACCATATCCGGCACATGTACCACAAAGTCGATCGCCGAATCTGCTGGGACTCGAGTCGAGGGATCCAAGCGGTATGCCAAGGAGATCCGGACAACTCGGCGCTGAATTTGCTGTGGAGCCTTTGGCGCTGGTTTCGCTGGCGATTTTCACACTGGATGGCGCATCTGTGACCGCAGCGGAGGACCGCTTAAATCCGCCATGGAAAAACGCAAATGCAGCCGGACAAGTCAGGACAAGTCACCTCCAAGGATGAAA

Full Affymetrix probeset data:

Annotations for 1641248_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720