FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641250_at:

>probe:Drosophila_2:1641250_at:683:309; Interrogation_Position=113; Antisense; CCAACTGGTGCTCCCGTCGATGGTA
>probe:Drosophila_2:1641250_at:553:617; Interrogation_Position=13; Antisense; TGCAGTCTTCAACCTGCTGTTTAGC
>probe:Drosophila_2:1641250_at:517:61; Interrogation_Position=132; Antisense; ATGGTACGACTAGCACGGGATTCTC
>probe:Drosophila_2:1641250_at:411:139; Interrogation_Position=146; Antisense; ACGGGATTCTCTGGTCCGCCGCAGG
>probe:Drosophila_2:1641250_at:332:633; Interrogation_Position=160; Antisense; TCCGCCGCAGGCTGAGACCACAAAT
>probe:Drosophila_2:1641250_at:279:609; Interrogation_Position=172; Antisense; TGAGACCACAAATGCCACGCCAGAA
>probe:Drosophila_2:1641250_at:497:165; Interrogation_Position=181; Antisense; AAATGCCACGCCAGAAACGTCGACC
>probe:Drosophila_2:1641250_at:249:107; Interrogation_Position=193; Antisense; AGAAACGTCGACCATCTATCCCATT
>probe:Drosophila_2:1641250_at:447:637; Interrogation_Position=200; Antisense; TCGACCATCTATCCCATTTACGGAT
>probe:Drosophila_2:1641250_at:501:707; Interrogation_Position=217; Antisense; TTACGGATAGTCATCATCGATTGAT
>probe:Drosophila_2:1641250_at:95:203; Interrogation_Position=23; Antisense; AACCTGCTGTTTAGCCTCTGTCTGG
>probe:Drosophila_2:1641250_at:8:643; Interrogation_Position=39; Antisense; TCTGTCTGGCCTTCATGCTGTGCAC
>probe:Drosophila_2:1641250_at:303:647; Interrogation_Position=51; Antisense; TCATGCTGTGCACCTCGTGGGTGTC
>probe:Drosophila_2:1641250_at:157:519; Interrogation_Position=67; Antisense; GTGGGTGTCGGCTTTCTCCAGTCTT

Paste this into a BLAST search page for me
CCAACTGGTGCTCCCGTCGATGGTATGCAGTCTTCAACCTGCTGTTTAGCATGGTACGACTAGCACGGGATTCTCACGGGATTCTCTGGTCCGCCGCAGGTCCGCCGCAGGCTGAGACCACAAATTGAGACCACAAATGCCACGCCAGAAAAATGCCACGCCAGAAACGTCGACCAGAAACGTCGACCATCTATCCCATTTCGACCATCTATCCCATTTACGGATTTACGGATAGTCATCATCGATTGATAACCTGCTGTTTAGCCTCTGTCTGGTCTGTCTGGCCTTCATGCTGTGCACTCATGCTGTGCACCTCGTGGGTGTCGTGGGTGTCGGCTTTCTCCAGTCTT

Full Affymetrix probeset data:

Annotations for 1641250_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720