FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641251_at:

>probe:Drosophila_2:1641251_at:337:77; Interrogation_Position=363; Antisense; AGGATGCGGAGCTCATACTGTCCAC
>probe:Drosophila_2:1641251_at:511:579; Interrogation_Position=388; Antisense; GGCCATCTTCCAAGCGCGACAGAAA
>probe:Drosophila_2:1641251_at:377:325; Interrogation_Position=403; Antisense; GCGACAGAAACTGGCCAGCATCAAT
>probe:Drosophila_2:1641251_at:708:255; Interrogation_Position=436; Antisense; CAAACGACCGGTTTCATCCGAGGAG
>probe:Drosophila_2:1641251_at:41:553; Interrogation_Position=457; Antisense; GGAGCTCATCAAATACGCACATCGG
>probe:Drosophila_2:1641251_at:658:39; Interrogation_Position=477; Antisense; ATCGGATTAGCTCCGCCAATGCGGT
>probe:Drosophila_2:1641251_at:599:683; Interrogation_Position=545; Antisense; TATCCCACGGACATTGAGATGCGCA
>probe:Drosophila_2:1641251_at:310:151; Interrogation_Position=597; Antisense; ACATCAACGGCGGAACAGTGACCCA
>probe:Drosophila_2:1641251_at:450:85; Interrogation_Position=613; Antisense; AGTGACCCACCAGAACAGCGGCATG
>probe:Drosophila_2:1641251_at:52:199; Interrogation_Position=655; Antisense; AACGCTGTCCGGTAGCGCAGGAAGT
>probe:Drosophila_2:1641251_at:153:309; Interrogation_Position=711; Antisense; CCAATGCCTTCCAGAACCAGTTTAA
>probe:Drosophila_2:1641251_at:260:39; Interrogation_Position=741; Antisense; ATCTCGGAGAGCTGCACATGACCAT
>probe:Drosophila_2:1641251_at:417:269; Interrogation_Position=763; Antisense; CATGGGCGCCTCTGGGAACACAGTG
>probe:Drosophila_2:1641251_at:609:435; Interrogation_Position=818; Antisense; GAGGTCATGTCCACGGATAGCTCAA

Paste this into a BLAST search page for me
AGGATGCGGAGCTCATACTGTCCACGGCCATCTTCCAAGCGCGACAGAAAGCGACAGAAACTGGCCAGCATCAATCAAACGACCGGTTTCATCCGAGGAGGGAGCTCATCAAATACGCACATCGGATCGGATTAGCTCCGCCAATGCGGTTATCCCACGGACATTGAGATGCGCAACATCAACGGCGGAACAGTGACCCAAGTGACCCACCAGAACAGCGGCATGAACGCTGTCCGGTAGCGCAGGAAGTCCAATGCCTTCCAGAACCAGTTTAAATCTCGGAGAGCTGCACATGACCATCATGGGCGCCTCTGGGAACACAGTGGAGGTCATGTCCACGGATAGCTCAA

Full Affymetrix probeset data:

Annotations for 1641251_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720