FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641252_at:

>probe:Drosophila_2:1641252_at:25:231; Interrogation_Position=2490; Antisense; AATGTGGCTGGCATAACCGCATCTA
>probe:Drosophila_2:1641252_at:286:641; Interrogation_Position=2558; Antisense; TCTGAACATGTTCCGCAACCTTAAT
>probe:Drosophila_2:1641252_at:599:247; Interrogation_Position=2573; Antisense; CAACCTTAATGCGTTCTTCTACAGT
>probe:Drosophila_2:1641252_at:104:715; Interrogation_Position=2586; Antisense; TTCTTCTACAGTCCGCATGGTGATG
>probe:Drosophila_2:1641252_at:407:83; Interrogation_Position=2612; Antisense; AGTGGCTAAGCTTCTGTTTCTTCAA
>probe:Drosophila_2:1641252_at:584:177; Interrogation_Position=2636; Antisense; AAACGGCGGCCGGATAGTCGACGAT
>probe:Drosophila_2:1641252_at:412:7; Interrogation_Position=2659; Antisense; ATTCCGATCCGCAACTAAATCTGGG
>probe:Drosophila_2:1641252_at:56:531; Interrogation_Position=2681; Antisense; GGGATTTATCTGTATGTCTTCTGAC
>probe:Drosophila_2:1641252_at:111:455; Interrogation_Position=2709; Antisense; GATAACGACCACTTCGAGCACTGGC
>probe:Drosophila_2:1641252_at:264:421; Interrogation_Position=2724; Antisense; GAGCACTGGCTGCACAATCATTCCA
>probe:Drosophila_2:1641252_at:598:237; Interrogation_Position=2739; Antisense; AATCATTCCAAGTTGACCACTGACA
>probe:Drosophila_2:1641252_at:534:397; Interrogation_Position=2760; Antisense; GACAAGGTCTTAAACTCGGCGTGGA
>probe:Drosophila_2:1641252_at:289:519; Interrogation_Position=2780; Antisense; GTGGATACATCAGTGCCATCGCGAA
>probe:Drosophila_2:1641252_at:132:279; Interrogation_Position=2818; Antisense; CTATGCATTCTTTCGTCTAACTCAA

Paste this into a BLAST search page for me
AATGTGGCTGGCATAACCGCATCTATCTGAACATGTTCCGCAACCTTAATCAACCTTAATGCGTTCTTCTACAGTTTCTTCTACAGTCCGCATGGTGATGAGTGGCTAAGCTTCTGTTTCTTCAAAAACGGCGGCCGGATAGTCGACGATATTCCGATCCGCAACTAAATCTGGGGGGATTTATCTGTATGTCTTCTGACGATAACGACCACTTCGAGCACTGGCGAGCACTGGCTGCACAATCATTCCAAATCATTCCAAGTTGACCACTGACAGACAAGGTCTTAAACTCGGCGTGGAGTGGATACATCAGTGCCATCGCGAACTATGCATTCTTTCGTCTAACTCAA

Full Affymetrix probeset data:

Annotations for 1641252_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720