FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641256_at:

>probe:Drosophila_2:1641256_at:267:527; Interrogation_Position=1019; Antisense; GGGAGCAGACTCTCCACGAGATGTA
>probe:Drosophila_2:1641256_at:251:227; Interrogation_Position=1132; Antisense; AAGGCCGCTCAATCCAGCTTTAATG
>probe:Drosophila_2:1641256_at:194:327; Interrogation_Position=622; Antisense; GCGATGACTCTCTACGGACCGGATA
>probe:Drosophila_2:1641256_at:4:27; Interrogation_Position=644; Antisense; ATACCAATCTGGGAGAGGCCTGCGC
>probe:Drosophila_2:1641256_at:22:171; Interrogation_Position=694; Antisense; AAAGGAGTGGAGTCGCCCTACTGTG
>probe:Drosophila_2:1641256_at:575:595; Interrogation_Position=715; Antisense; TGTGGCATCGCCAACTACATGTATC
>probe:Drosophila_2:1641256_at:438:667; Interrogation_Position=730; Antisense; TACATGTATCCGCACTGCAAGGTAG
>probe:Drosophila_2:1641256_at:45:291; Interrogation_Position=765; Antisense; CGTAGAGGCCCTGGAGTTCCTGGAA
>probe:Drosophila_2:1641256_at:473:219; Interrogation_Position=799; Antisense; AAGTCCTTCAAAATCCGGCGGATGA
>probe:Drosophila_2:1641256_at:717:695; Interrogation_Position=847; Antisense; TTTCACACTCCTCTAATGCAAAGCG
>probe:Drosophila_2:1641256_at:513:53; Interrogation_Position=862; Antisense; ATGCAAAGCGCCGTGGAGCCATTTA
>probe:Drosophila_2:1641256_at:80:395; Interrogation_Position=877; Antisense; GAGCCATTTACCAAAGCCCTGAAAA
>probe:Drosophila_2:1641256_at:71:73; Interrogation_Position=914; Antisense; AGGACCCCGTCATTAGAGTGTACTC
>probe:Drosophila_2:1641256_at:44:211; Interrogation_Position=994; Antisense; AAGCAAATCGTGAGGCCCGTCAAGT

Paste this into a BLAST search page for me
GGGAGCAGACTCTCCACGAGATGTAAAGGCCGCTCAATCCAGCTTTAATGGCGATGACTCTCTACGGACCGGATAATACCAATCTGGGAGAGGCCTGCGCAAAGGAGTGGAGTCGCCCTACTGTGTGTGGCATCGCCAACTACATGTATCTACATGTATCCGCACTGCAAGGTAGCGTAGAGGCCCTGGAGTTCCTGGAAAAGTCCTTCAAAATCCGGCGGATGATTTCACACTCCTCTAATGCAAAGCGATGCAAAGCGCCGTGGAGCCATTTAGAGCCATTTACCAAAGCCCTGAAAAAGGACCCCGTCATTAGAGTGTACTCAAGCAAATCGTGAGGCCCGTCAAGT

Full Affymetrix probeset data:

Annotations for 1641256_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720