Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641259_at:

>probe:Drosophila_2:1641259_at:299:503; Interrogation_Position=1013; Antisense; GTCGCCCATGGAAACTGACCGATGA
>probe:Drosophila_2:1641259_at:327:445; Interrogation_Position=1033; Antisense; GATGACTCTGGCGACACTGGTGTTC
>probe:Drosophila_2:1641259_at:203:81; Interrogation_Position=1106; Antisense; AGGTGCCTGGCATTTACAGCTGGCC
>probe:Drosophila_2:1641259_at:692:231; Interrogation_Position=1183; Antisense; AATGCTCCGCTGATCAAGGTTCAGG
>probe:Drosophila_2:1641259_at:177:223; Interrogation_Position=1198; Antisense; AAGGTTCAGGATCCTGCCAAGCGTT
>probe:Drosophila_2:1641259_at:696:203; Interrogation_Position=1216; Antisense; AAGCGTTTCGGCTCTTATGCCTACA
>probe:Drosophila_2:1641259_at:313:161; Interrogation_Position=1262; Antisense; ACAATGGCATCTGGGTGAGCTTCGA
>probe:Drosophila_2:1641259_at:719:511; Interrogation_Position=1276; Antisense; GTGAGCTTCGAGGATCCCGATACTG
>probe:Drosophila_2:1641259_at:202:33; Interrogation_Position=1307; Antisense; ATAAGGCCGGCTATGTGCGCACTGA
>probe:Drosophila_2:1641259_at:478:165; Interrogation_Position=1332; Antisense; AAATCTGGGTGGAGTCGCGCTATTC
>probe:Drosophila_2:1641259_at:538:413; Interrogation_Position=1357; Antisense; GACCTGTCCTACGATGATTTCCGAG
>probe:Drosophila_2:1641259_at:501:437; Interrogation_Position=1379; Antisense; GAGGACTCTGCACCAACGAGAAGTA
>probe:Drosophila_2:1641259_at:561:521; Interrogation_Position=1415; Antisense; GGGCCATTAAGTATCGTCTGACCAA
>probe:Drosophila_2:1641259_at:315:597; Interrogation_Position=973; Antisense; TGTCCCGCCAGCAAGATCAATGTGG

Paste this into a BLAST search page for me
GTCGCCCATGGAAACTGACCGATGAGATGACTCTGGCGACACTGGTGTTCAGGTGCCTGGCATTTACAGCTGGCCAATGCTCCGCTGATCAAGGTTCAGGAAGGTTCAGGATCCTGCCAAGCGTTAAGCGTTTCGGCTCTTATGCCTACAACAATGGCATCTGGGTGAGCTTCGAGTGAGCTTCGAGGATCCCGATACTGATAAGGCCGGCTATGTGCGCACTGAAAATCTGGGTGGAGTCGCGCTATTCGACCTGTCCTACGATGATTTCCGAGGAGGACTCTGCACCAACGAGAAGTAGGGCCATTAAGTATCGTCTGACCAATGTCCCGCCAGCAAGATCAATGTGG

Full Affymetrix probeset data:

Annotations for 1641259_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime