FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641262_at:

>probe:Drosophila_2:1641262_at:3:115; Interrogation_Position=105; Antisense; AGCAGAGGACCATCAGTACTTCATC
>probe:Drosophila_2:1641262_at:320:489; Interrogation_Position=120; Antisense; GTACTTCATCCGTGCTGGAGGGCAA
>probe:Drosophila_2:1641262_at:271:389; Interrogation_Position=208; Antisense; GAAAACACTGGCCAATCCGCCGGTA
>probe:Drosophila_2:1641262_at:702:317; Interrogation_Position=226; Antisense; GCCGGTAGCCATTCACAAGCGAGGT
>probe:Drosophila_2:1641262_at:225:157; Interrogation_Position=258; Antisense; ACACGGGCATACTTGTCGACGGGCA
>probe:Drosophila_2:1641262_at:434:401; Interrogation_Position=311; Antisense; GACATCATAGTTCCCGATTTGACCG
>probe:Drosophila_2:1641262_at:21:693; Interrogation_Position=328; Antisense; TTTGACCGGTTGTAAGCTAAAGCCA
>probe:Drosophila_2:1641262_at:377:169; Interrogation_Position=346; Antisense; AAAGCCATACGTGTCCTATAAGGCG
>probe:Drosophila_2:1641262_at:398:93; Interrogation_Position=390; Antisense; AGTTCACCAGCTTGGATCTCTTCAA
>probe:Drosophila_2:1641262_at:240:199; Interrogation_Position=413; Antisense; AACGCCGTCTACTCGCAGAAGATTA
>probe:Drosophila_2:1641262_at:222:225; Interrogation_Position=482; Antisense; AAGGAGCCCTCGGTCAATGAGCAAC
>probe:Drosophila_2:1641262_at:622:141; Interrogation_Position=523; Antisense; CTTGCAACGCGCTCGAAAGACGGGC
>probe:Drosophila_2:1641262_at:39:409; Interrogation_Position=541; Antisense; GACGGGCAGCGATATATTCTAGACA
>probe:Drosophila_2:1641262_at:339:663; Interrogation_Position=76; Antisense; TAAAGTAGTGCCCATTGCCCTAAGG

Paste this into a BLAST search page for me
AGCAGAGGACCATCAGTACTTCATCGTACTTCATCCGTGCTGGAGGGCAAGAAAACACTGGCCAATCCGCCGGTAGCCGGTAGCCATTCACAAGCGAGGTACACGGGCATACTTGTCGACGGGCAGACATCATAGTTCCCGATTTGACCGTTTGACCGGTTGTAAGCTAAAGCCAAAAGCCATACGTGTCCTATAAGGCGAGTTCACCAGCTTGGATCTCTTCAAAACGCCGTCTACTCGCAGAAGATTAAAGGAGCCCTCGGTCAATGAGCAACCTTGCAACGCGCTCGAAAGACGGGCGACGGGCAGCGATATATTCTAGACATAAAGTAGTGCCCATTGCCCTAAGG

Full Affymetrix probeset data:

Annotations for 1641262_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720