FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641263_at:

>probe:Drosophila_2:1641263_at:140:157; Interrogation_Position=103; Antisense; AACCGGTATAAATAATCCCCTCATG
>probe:Drosophila_2:1641263_at:704:309; Interrogation_Position=143; Antisense; CCAAAGAATGGTCGCGAGCTCGCCT
>probe:Drosophila_2:1641263_at:54:419; Interrogation_Position=158; Antisense; GAGCTCGCCTATGTAAGCCTAAGGA
>probe:Drosophila_2:1641263_at:330:545; Interrogation_Position=180; Antisense; GGATAATCTTACCACCGAAGCGGGA
>probe:Drosophila_2:1641263_at:169:177; Interrogation_Position=205; Antisense; AAACGAGAACGCTTTGTGCCGTCCT
>probe:Drosophila_2:1641263_at:410:725; Interrogation_Position=218; Antisense; TTGTGCCGTCCTGCGAGCTAGAGTG
>probe:Drosophila_2:1641263_at:495:117; Interrogation_Position=233; Antisense; AGCTAGAGTGCAGTCCGGTATCGAT
>probe:Drosophila_2:1641263_at:351:483; Interrogation_Position=250; Antisense; GTATCGATGTCGCACTTGATTGGCT
>probe:Drosophila_2:1641263_at:40:467; Interrogation_Position=267; Antisense; GATTGGCTGGGAGTACGCTAGAATT
>probe:Drosophila_2:1641263_at:64:279; Interrogation_Position=284; Antisense; CTAGAATTTGGCTGCGCGATCGCGA
>probe:Drosophila_2:1641263_at:103:451; Interrogation_Position=301; Antisense; GATCGCGACGAATTTGTGCAGCAAC
>probe:Drosophila_2:1641263_at:568:359; Interrogation_Position=321; Antisense; GCAACGCGAACGTGCTGTCAAAGCT
>probe:Drosophila_2:1641263_at:398:399; Interrogation_Position=442; Antisense; GACAGCGAAATTATTCCTATTCCAT
>probe:Drosophila_2:1641263_at:699:653; Interrogation_Position=65; Antisense; TAAGTTTTTATACATTGTCACCGAC

Paste this into a BLAST search page for me
AACCGGTATAAATAATCCCCTCATGCCAAAGAATGGTCGCGAGCTCGCCTGAGCTCGCCTATGTAAGCCTAAGGAGGATAATCTTACCACCGAAGCGGGAAAACGAGAACGCTTTGTGCCGTCCTTTGTGCCGTCCTGCGAGCTAGAGTGAGCTAGAGTGCAGTCCGGTATCGATGTATCGATGTCGCACTTGATTGGCTGATTGGCTGGGAGTACGCTAGAATTCTAGAATTTGGCTGCGCGATCGCGAGATCGCGACGAATTTGTGCAGCAACGCAACGCGAACGTGCTGTCAAAGCTGACAGCGAAATTATTCCTATTCCATTAAGTTTTTATACATTGTCACCGAC

Full Affymetrix probeset data:

Annotations for 1641263_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720