FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641266_at:

>probe:Drosophila_2:1641266_at:251:199; Interrogation_Position=1128; Antisense; AACGCAAACGAATGTGCCACTTGGG
>probe:Drosophila_2:1641266_at:151:149; Interrogation_Position=1146; Antisense; ACTTGGGAACGGTGTTGCAGCTGCA
>probe:Drosophila_2:1641266_at:246:119; Interrogation_Position=1170; Antisense; AGCTGCATTTGCATCGGGACCGAAA
>probe:Drosophila_2:1641266_at:151:313; Interrogation_Position=628; Antisense; GCCACACGCAGCTTGAGTTCCGAGA
>probe:Drosophila_2:1641266_at:214:93; Interrogation_Position=643; Antisense; AGTTCCGAGAGCAACTGCGACAGCA
>probe:Drosophila_2:1641266_at:710:109; Interrogation_Position=664; Antisense; AGCAAGTCACCCTTTGTGCTGCAAA
>probe:Drosophila_2:1641266_at:582:133; Interrogation_Position=688; Antisense; ACGCTGAAGCGTCTGGAGAAGTCTC
>probe:Drosophila_2:1641266_at:74:223; Interrogation_Position=713; Antisense; AATCCATACTGGTCATACGCAACTC
>probe:Drosophila_2:1641266_at:397:717; Interrogation_Position=800; Antisense; TTGCCACCTCAAGTATTCTAAGCGT
>probe:Drosophila_2:1641266_at:629:583; Interrogation_Position=854; Antisense; TGGCAGGAGCGCTGCACAAGCTCAA
>probe:Drosophila_2:1641266_at:211:555; Interrogation_Position=910; Antisense; GGAGCCTCATCAGCCGGAGCAACAT
>probe:Drosophila_2:1641266_at:77:553; Interrogation_Position=925; Antisense; GGAGCAACATCATCTACGGCCACCA
>probe:Drosophila_2:1641266_at:514:573; Interrogation_Position=942; Antisense; GGCCACCACCATACTAAGGCTGGGA
>probe:Drosophila_2:1641266_at:328:573; Interrogation_Position=959; Antisense; GGCTGGGAAAAAGCGCCACCACGGT

Paste this into a BLAST search page for me
AACGCAAACGAATGTGCCACTTGGGACTTGGGAACGGTGTTGCAGCTGCAAGCTGCATTTGCATCGGGACCGAAAGCCACACGCAGCTTGAGTTCCGAGAAGTTCCGAGAGCAACTGCGACAGCAAGCAAGTCACCCTTTGTGCTGCAAAACGCTGAAGCGTCTGGAGAAGTCTCAATCCATACTGGTCATACGCAACTCTTGCCACCTCAAGTATTCTAAGCGTTGGCAGGAGCGCTGCACAAGCTCAAGGAGCCTCATCAGCCGGAGCAACATGGAGCAACATCATCTACGGCCACCAGGCCACCACCATACTAAGGCTGGGAGGCTGGGAAAAAGCGCCACCACGGT

Full Affymetrix probeset data:

Annotations for 1641266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720