Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641267_at:

>probe:Drosophila_2:1641267_at:475:123; Interrogation_Position=6815; Antisense; AGCCGGGAGATCGACTCGGACCCAA
>probe:Drosophila_2:1641267_at:352:59; Interrogation_Position=6872; Antisense; ATGTACATCCGTATGGCCTTGCTGG
>probe:Drosophila_2:1641267_at:90:315; Interrogation_Position=6896; Antisense; GCCATGGTCGTTGGTGGACGCAATA
>probe:Drosophila_2:1641267_at:134:533; Interrogation_Position=6908; Antisense; GGTGGACGCAATACGGCGCTCTAGA
>probe:Drosophila_2:1641267_at:298:577; Interrogation_Position=6922; Antisense; GGCGCTCTAGAGGATTTACCCATGG
>probe:Drosophila_2:1641267_at:647:559; Interrogation_Position=6945; Antisense; GGAAAACCCACAATCTTTGACTCTC
>probe:Drosophila_2:1641267_at:560:277; Interrogation_Position=6959; Antisense; CTTTGACTCTCTACTATTATTTTTG
>probe:Drosophila_2:1641267_at:543:703; Interrogation_Position=6997; Antisense; TTATACCACACATGTACGCAGCTGC
>probe:Drosophila_2:1641267_at:63:673; Interrogation_Position=7011; Antisense; TACGCAGCTGCATACGAATATATTT
>probe:Drosophila_2:1641267_at:200:449; Interrogation_Position=7036; Antisense; GATCCATTTCGGTTAATTGTTTGTG
>probe:Drosophila_2:1641267_at:705:665; Interrogation_Position=7082; Antisense; TACTTGTATCTGCATCCAAAACATG
>probe:Drosophila_2:1641267_at:335:279; Interrogation_Position=7291; Antisense; CTAAGTGTCAGTCTCAAACGTTTAC
>probe:Drosophila_2:1641267_at:353:241; Interrogation_Position=7316; Antisense; AATAAACATCACGTGCCCATGTGCC
>probe:Drosophila_2:1641267_at:320:141; Interrogation_Position=7349; Antisense; ACGGTGGTGCTTGGTGCTTCCTGCT

Paste this into a BLAST search page for me
AGCCGGGAGATCGACTCGGACCCAAATGTACATCCGTATGGCCTTGCTGGGCCATGGTCGTTGGTGGACGCAATAGGTGGACGCAATACGGCGCTCTAGAGGCGCTCTAGAGGATTTACCCATGGGGAAAACCCACAATCTTTGACTCTCCTTTGACTCTCTACTATTATTTTTGTTATACCACACATGTACGCAGCTGCTACGCAGCTGCATACGAATATATTTGATCCATTTCGGTTAATTGTTTGTGTACTTGTATCTGCATCCAAAACATGCTAAGTGTCAGTCTCAAACGTTTACAATAAACATCACGTGCCCATGTGCCACGGTGGTGCTTGGTGCTTCCTGCT

Full Affymetrix probeset data:

Annotations for 1641267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime