Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641268_at:

>probe:Drosophila_2:1641268_at:671:495; Interrogation_Position=1271; Antisense; GTCAGTCCGATAACCATCTCAGTGG
>probe:Drosophila_2:1641268_at:612:579; Interrogation_Position=1293; Antisense; TGGCCACCTCCGGAAGTTATACATT
>probe:Drosophila_2:1641268_at:146:111; Interrogation_Position=1343; Antisense; AGAATGCTGGGATGCACGTCGGCCA
>probe:Drosophila_2:1641268_at:515:577; Interrogation_Position=1378; Antisense; GGCCGGTTGCCTGCAATACTATATG
>probe:Drosophila_2:1641268_at:337:553; Interrogation_Position=1412; Antisense; GGCACCCTGGCCAGTTTTAATTACA
>probe:Drosophila_2:1641268_at:205:697; Interrogation_Position=1427; Antisense; TTTAATTACAATTCGGCGGCGGCCT
>probe:Drosophila_2:1641268_at:481:245; Interrogation_Position=1460; Antisense; AATTCCATTGGTGTGCAGGGCACGA
>probe:Drosophila_2:1641268_at:307:527; Interrogation_Position=1531; Antisense; GGGAATGTGCTCCATTACCTACAGC
>probe:Drosophila_2:1641268_at:242:467; Interrogation_Position=1559; Antisense; GTTGGCTCCGATACGTATTCCTTTA
>probe:Drosophila_2:1641268_at:210:685; Interrogation_Position=1574; Antisense; TATTCCTTTACGCTGACCAACGATG
>probe:Drosophila_2:1641268_at:520:557; Interrogation_Position=1660; Antisense; GGACTATATCATCATTCCGTCGCCA
>probe:Drosophila_2:1641268_at:245:203; Interrogation_Position=1757; Antisense; AAGCCATTCGTTGTCTACACAGTCA
>probe:Drosophila_2:1641268_at:544:557; Interrogation_Position=1801; Antisense; GGACATATCGAATCGCGGCTTCTAC
>probe:Drosophila_2:1641268_at:277:571; Interrogation_Position=1817; Antisense; GGCTTCTACTTGTCGTATTCGCAGA

Paste this into a BLAST search page for me
GTCAGTCCGATAACCATCTCAGTGGTGGCCACCTCCGGAAGTTATACATTAGAATGCTGGGATGCACGTCGGCCAGGCCGGTTGCCTGCAATACTATATGGGCACCCTGGCCAGTTTTAATTACATTTAATTACAATTCGGCGGCGGCCTAATTCCATTGGTGTGCAGGGCACGAGGGAATGTGCTCCATTACCTACAGCGTTGGCTCCGATACGTATTCCTTTATATTCCTTTACGCTGACCAACGATGGGACTATATCATCATTCCGTCGCCAAAGCCATTCGTTGTCTACACAGTCAGGACATATCGAATCGCGGCTTCTACGGCTTCTACTTGTCGTATTCGCAGA

Full Affymetrix probeset data:

Annotations for 1641268_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime