FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641269_at:

>probe:Drosophila_2:1641269_at:187:575; Interrogation_Position=1011; Antisense; GGCGGACAGCCTAAGTCTACATTTT
>probe:Drosophila_2:1641269_at:724:657; Interrogation_Position=1022; Antisense; TAAGTCTACATTTTCGCACGCATGC
>probe:Drosophila_2:1641269_at:564:347; Interrogation_Position=1041; Antisense; GCATGCGGCGAATAATAATCTACTG
>probe:Drosophila_2:1641269_at:524:237; Interrogation_Position=1057; Antisense; AATCTACTGAATTTGCCGTTGCCTC
>probe:Drosophila_2:1641269_at:343:681; Interrogation_Position=1092; Antisense; TATGTCGCATCACTACCATCACGAT
>probe:Drosophila_2:1641269_at:666:229; Interrogation_Position=1155; Antisense; AATGGGAATGGCTGCAATGGCTCAC
>probe:Drosophila_2:1641269_at:16:617; Interrogation_Position=1167; Antisense; TGCAATGGCTCACATGTTGGCACCG
>probe:Drosophila_2:1641269_at:210:225; Interrogation_Position=1220; Antisense; AAGGACGTTACACTATGCTGCACCA
>probe:Drosophila_2:1641269_at:230:155; Interrogation_Position=1244; Antisense; ACACGGCGGCACAAAGACTACATTA
>probe:Drosophila_2:1641269_at:654:247; Interrogation_Position=863; Antisense; AATTGAAGCTTCATCCTCTGGAGTC
>probe:Drosophila_2:1641269_at:198:549; Interrogation_Position=882; Antisense; GGAGTCCAGTACAAACCATGATATA
>probe:Drosophila_2:1641269_at:142:57; Interrogation_Position=923; Antisense; ATGAGGCTATAGACACGGATCCCGT
>probe:Drosophila_2:1641269_at:545:309; Interrogation_Position=972; Antisense; CCACTTCAAGTGTCCGGATTGCGAC
>probe:Drosophila_2:1641269_at:46:251; Interrogation_Position=996; Antisense; CAAGGCATTTGATACGGCGGACAGC

Paste this into a BLAST search page for me
GGCGGACAGCCTAAGTCTACATTTTTAAGTCTACATTTTCGCACGCATGCGCATGCGGCGAATAATAATCTACTGAATCTACTGAATTTGCCGTTGCCTCTATGTCGCATCACTACCATCACGATAATGGGAATGGCTGCAATGGCTCACTGCAATGGCTCACATGTTGGCACCGAAGGACGTTACACTATGCTGCACCAACACGGCGGCACAAAGACTACATTAAATTGAAGCTTCATCCTCTGGAGTCGGAGTCCAGTACAAACCATGATATAATGAGGCTATAGACACGGATCCCGTCCACTTCAAGTGTCCGGATTGCGACCAAGGCATTTGATACGGCGGACAGC

Full Affymetrix probeset data:

Annotations for 1641269_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720