Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641270_at:

>probe:Drosophila_2:1641270_at:136:365; Interrogation_Position=1880; Antisense; GAATTAGACCCACTTATCTGTAATC
>probe:Drosophila_2:1641270_at:336:483; Interrogation_Position=1925; Antisense; GTATAATCATTATCCTCTTCGCCAA
>probe:Drosophila_2:1641270_at:53:307; Interrogation_Position=1938; Antisense; CCTCTTCGCCAATTATCTTCTAGTA
>probe:Drosophila_2:1641270_at:419:481; Interrogation_Position=1960; Antisense; GTATCTAGAAACGTAGGGAGCCCAG
>probe:Drosophila_2:1641270_at:188:527; Interrogation_Position=1975; Antisense; GGGAGCCCAGAACGAATTTCTTGAA
>probe:Drosophila_2:1641270_at:341:363; Interrogation_Position=1997; Antisense; GAATTGTTATATCCCCAACATCATG
>probe:Drosophila_2:1641270_at:334:179; Interrogation_Position=2135; Antisense; AAACTTCTGTGCGATTTCTCGACAC
>probe:Drosophila_2:1641270_at:692:325; Interrogation_Position=2145; Antisense; GCGATTTCTCGACACAACATTTAAT
>probe:Drosophila_2:1641270_at:467:527; Interrogation_Position=2174; Antisense; GGTAAATACTGTTTTGCTTGTCAAG
>probe:Drosophila_2:1641270_at:303:531; Interrogation_Position=2201; Antisense; GGGTGAGACTTTACTGATCACGTTG
>probe:Drosophila_2:1641270_at:219:453; Interrogation_Position=2216; Antisense; GATCACGTTGATCCGCCTAATTTTA
>probe:Drosophila_2:1641270_at:189:363; Interrogation_Position=2294; Antisense; GAATATTCTACCTTTTCTGGGTGTA
>probe:Drosophila_2:1641270_at:52:29; Interrogation_Position=2326; Antisense; ATAAAAACCCCGATGAGTATGCAAA
>probe:Drosophila_2:1641270_at:614:475; Interrogation_Position=2352; Antisense; GTTTGATGCGGCTAACGTTGAGTTA

Paste this into a BLAST search page for me
GAATTAGACCCACTTATCTGTAATCGTATAATCATTATCCTCTTCGCCAACCTCTTCGCCAATTATCTTCTAGTAGTATCTAGAAACGTAGGGAGCCCAGGGGAGCCCAGAACGAATTTCTTGAAGAATTGTTATATCCCCAACATCATGAAACTTCTGTGCGATTTCTCGACACGCGATTTCTCGACACAACATTTAATGGTAAATACTGTTTTGCTTGTCAAGGGGTGAGACTTTACTGATCACGTTGGATCACGTTGATCCGCCTAATTTTAGAATATTCTACCTTTTCTGGGTGTAATAAAAACCCCGATGAGTATGCAAAGTTTGATGCGGCTAACGTTGAGTTA

Full Affymetrix probeset data:

Annotations for 1641270_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime