FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641271_at:

>probe:Drosophila_2:1641271_at:579:255; Interrogation_Position=1012; Antisense; CAAACATTATGCTGCCGAACGGCGA
>probe:Drosophila_2:1641271_at:250:455; Interrogation_Position=1104; Antisense; GATCAAACCGAAGGCCACTCAGTGA
>probe:Drosophila_2:1641271_at:196:715; Interrogation_Position=571; Antisense; TTCTGGAATCGATGGCCGGATGCAC
>probe:Drosophila_2:1641271_at:458:363; Interrogation_Position=604; Antisense; GAATTCGACGAAGTTCTCGCGCCTG
>probe:Drosophila_2:1641271_at:386:317; Interrogation_Position=624; Antisense; GCCTGGTTACATTGCCGGAGTGATA
>probe:Drosophila_2:1641271_at:4:659; Interrogation_Position=647; Antisense; TAACGCCGGGTTTTGTGATCATCTG
>probe:Drosophila_2:1641271_at:557:545; Interrogation_Position=671; Antisense; GGATCTGTATGTTCCTCGTCTACTG
>probe:Drosophila_2:1641271_at:103:399; Interrogation_Position=737; Antisense; GACAGTCGGTGGTCTACAACACGGA
>probe:Drosophila_2:1641271_at:29:213; Interrogation_Position=805; Antisense; AAGAGCGTCCAGATTGTGGTCTTCA
>probe:Drosophila_2:1641271_at:471:519; Interrogation_Position=820; Antisense; GTGGTCTTCATCATGGGCTGCTTCA
>probe:Drosophila_2:1641271_at:328:673; Interrogation_Position=857; Antisense; TACCGTACTTCTGTGTGGCCATTGC
>probe:Drosophila_2:1641271_at:100:581; Interrogation_Position=872; Antisense; TGGCCATTGCCCAGCTATTTAGCAT
>probe:Drosophila_2:1641271_at:218:521; Interrogation_Position=978; Antisense; GTGGAAGAACTCTGGCTTTCGGCGA
>probe:Drosophila_2:1641271_at:625:695; Interrogation_Position=994; Antisense; TTTCGGCGAGCCTTTGTCCAAACAT

Paste this into a BLAST search page for me
CAAACATTATGCTGCCGAACGGCGAGATCAAACCGAAGGCCACTCAGTGATTCTGGAATCGATGGCCGGATGCACGAATTCGACGAAGTTCTCGCGCCTGGCCTGGTTACATTGCCGGAGTGATATAACGCCGGGTTTTGTGATCATCTGGGATCTGTATGTTCCTCGTCTACTGGACAGTCGGTGGTCTACAACACGGAAAGAGCGTCCAGATTGTGGTCTTCAGTGGTCTTCATCATGGGCTGCTTCATACCGTACTTCTGTGTGGCCATTGCTGGCCATTGCCCAGCTATTTAGCATGTGGAAGAACTCTGGCTTTCGGCGATTTCGGCGAGCCTTTGTCCAAACAT

Full Affymetrix probeset data:

Annotations for 1641271_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720