Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641272_at:

>probe:Drosophila_2:1641272_at:210:117; Interrogation_Position=13540; Antisense; AGCATTACGCACAAGGCGTCGCCGC
>probe:Drosophila_2:1641272_at:12:267; Interrogation_Position=13581; Antisense; CAGGGAGCTAGATCCTTCGGCGGAC
>probe:Drosophila_2:1641272_at:404:361; Interrogation_Position=13610; Antisense; GCAAGGACACGCAGTTCCTGGTGGA
>probe:Drosophila_2:1641272_at:679:431; Interrogation_Position=13648; Antisense; GAGTGCTGATATCAAGCCCGTCAAT
>probe:Drosophila_2:1641272_at:499:295; Interrogation_Position=13665; Antisense; CCGTCAATCGGCTGTCGTTGCGGCG
>probe:Drosophila_2:1641272_at:706:93; Interrogation_Position=13692; Antisense; AGTTGCGATGGCCAGTTGCCGCCAA
>probe:Drosophila_2:1641272_at:409:113; Interrogation_Position=13739; Antisense; AGCAGCATCCCGAGAACAGCTATCC
>probe:Drosophila_2:1641272_at:124:341; Interrogation_Position=13757; Antisense; GCTATCCGCTGCAGACATAACACAT
>probe:Drosophila_2:1641272_at:608:397; Interrogation_Position=13853; Antisense; GACAGGGACGTTCTAGTAGTAAACA
>probe:Drosophila_2:1641272_at:709:491; Interrogation_Position=13871; Antisense; GTAAACATCACAAATCCTGGCAGGT
>probe:Drosophila_2:1641272_at:472:79; Interrogation_Position=13892; Antisense; AGGTAGCCACCGCTGGCAAGGTCAC
>probe:Drosophila_2:1641272_at:262:221; Interrogation_Position=13909; Antisense; AAGGTCACCACCAAGGTCTAGCCGT
>probe:Drosophila_2:1641272_at:191:499; Interrogation_Position=13924; Antisense; GTCTAGCCGTGACCCCAACAGAAAA
>probe:Drosophila_2:1641272_at:331:261; Interrogation_Position=13956; Antisense; CACCCACAGAGAGTAGCAACACGAT

Paste this into a BLAST search page for me
AGCATTACGCACAAGGCGTCGCCGCCAGGGAGCTAGATCCTTCGGCGGACGCAAGGACACGCAGTTCCTGGTGGAGAGTGCTGATATCAAGCCCGTCAATCCGTCAATCGGCTGTCGTTGCGGCGAGTTGCGATGGCCAGTTGCCGCCAAAGCAGCATCCCGAGAACAGCTATCCGCTATCCGCTGCAGACATAACACATGACAGGGACGTTCTAGTAGTAAACAGTAAACATCACAAATCCTGGCAGGTAGGTAGCCACCGCTGGCAAGGTCACAAGGTCACCACCAAGGTCTAGCCGTGTCTAGCCGTGACCCCAACAGAAAACACCCACAGAGAGTAGCAACACGAT

Full Affymetrix probeset data:

Annotations for 1641272_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime