Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641275_at:

>probe:Drosophila_2:1641275_at:135:341; Interrogation_Position=160; Antisense; GGTAGTAACAGCGAGGAACCCACTA
>probe:Drosophila_2:1641275_at:604:433; Interrogation_Position=172; Antisense; GAGGAACCCACTACTACTACGGAGG
>probe:Drosophila_2:1641275_at:631:667; Interrogation_Position=186; Antisense; TACTACGGAGGCTTTCCAGATCTCA
>probe:Drosophila_2:1641275_at:558:693; Interrogation_Position=198; Antisense; TTTCCAGATCTCACGCTATGAACTG
>probe:Drosophila_2:1641275_at:379:195; Interrogation_Position=218; Antisense; AACTGGGTCGCATTCTGGGCAGGAA
>probe:Drosophila_2:1641275_at:553:531; Interrogation_Position=249; Antisense; GGGTCTTCAAAAGTTGGCCATGAGT
>probe:Drosophila_2:1641275_at:266:55; Interrogation_Position=268; Antisense; ATGAGTGAGTTCAGCACGGCCCTAA
>probe:Drosophila_2:1641275_at:476:305; Interrogation_Position=288; Antisense; CCTAAACGCCACCAAGTACAATCTG
>probe:Drosophila_2:1641275_at:681:237; Interrogation_Position=307; Antisense; AATCTGGCTGAGTACAAATCCGAGG
>probe:Drosophila_2:1641275_at:123:439; Interrogation_Position=328; Antisense; GAGGCGGATAAACAGTTTGCCAACA
>probe:Drosophila_2:1641275_at:588:223; Interrogation_Position=37; Antisense; AAGGATCCGAGTTCCCAGGATGCAC
>probe:Drosophila_2:1641275_at:162:547; Interrogation_Position=54; Antisense; GGATGCACCGCATATACGACACAAG
>probe:Drosophila_2:1641275_at:279:685; Interrogation_Position=66; Antisense; TATACGACACAAGCGCGGAATCTTT
>probe:Drosophila_2:1641275_at:206:563; Interrogation_Position=82; Antisense; GGAATCTTTTGGGACTTCTTCCAGA

Paste this into a BLAST search page for me
GGTAGTAACAGCGAGGAACCCACTAGAGGAACCCACTACTACTACGGAGGTACTACGGAGGCTTTCCAGATCTCATTTCCAGATCTCACGCTATGAACTGAACTGGGTCGCATTCTGGGCAGGAAGGGTCTTCAAAAGTTGGCCATGAGTATGAGTGAGTTCAGCACGGCCCTAACCTAAACGCCACCAAGTACAATCTGAATCTGGCTGAGTACAAATCCGAGGGAGGCGGATAAACAGTTTGCCAACAAAGGATCCGAGTTCCCAGGATGCACGGATGCACCGCATATACGACACAAGTATACGACACAAGCGCGGAATCTTTGGAATCTTTTGGGACTTCTTCCAGA

Full Affymetrix probeset data:

Annotations for 1641275_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime