FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641276_at:

>probe:Drosophila_2:1641276_at:726:539; Interrogation_Position=1005; Antisense; GGTTGGACACAGAGCAGGAAGTATT
>probe:Drosophila_2:1641276_at:499:419; Interrogation_Position=1016; Antisense; GAGCAGGAAGTATTTTGGCCAGCAA
>probe:Drosophila_2:1641276_at:293:527; Interrogation_Position=1053; Antisense; GGGAATCTCGGTGTGCTTGGCATAC
>probe:Drosophila_2:1641276_at:505:343; Interrogation_Position=1067; Antisense; GCTTGGCATACTTGAAATTTCCGAT
>probe:Drosophila_2:1641276_at:443:695; Interrogation_Position=1084; Antisense; TTTCCGATATCTTTTGTGTTCTCAT
>probe:Drosophila_2:1641276_at:391:273; Interrogation_Position=1106; Antisense; CATATATTTGTTTTGTTCCTGCAGA
>probe:Drosophila_2:1641276_at:193:21; Interrogation_Position=1111; Antisense; ATTTGTTTTGTTCCTGCAGATGTTT
>probe:Drosophila_2:1641276_at:531:99; Interrogation_Position=1128; Antisense; AGATGTTTTGCGTTTGTGACCTCAC
>probe:Drosophila_2:1641276_at:249:511; Interrogation_Position=1143; Antisense; GTGACCTCACAATTTGAGTTTCCAG
>probe:Drosophila_2:1641276_at:690:429; Interrogation_Position=1158; Antisense; GAGTTTCCAGTAAGCTTTATTTCCA
>probe:Drosophila_2:1641276_at:85:343; Interrogation_Position=1171; Antisense; GCTTTATTTCCATTTTCTGCTATTT
>probe:Drosophila_2:1641276_at:213:17; Interrogation_Position=1182; Antisense; ATTTTCTGCTATTTATGGCCTTTAA
>probe:Drosophila_2:1641276_at:397:679; Interrogation_Position=1195; Antisense; TATGGCCTTTAATTCCTCTTATTTA
>probe:Drosophila_2:1641276_at:433:461; Interrogation_Position=991; Antisense; GATTCGATTTAATGGGTTGGACACA

Paste this into a BLAST search page for me
GGTTGGACACAGAGCAGGAAGTATTGAGCAGGAAGTATTTTGGCCAGCAAGGGAATCTCGGTGTGCTTGGCATACGCTTGGCATACTTGAAATTTCCGATTTTCCGATATCTTTTGTGTTCTCATCATATATTTGTTTTGTTCCTGCAGAATTTGTTTTGTTCCTGCAGATGTTTAGATGTTTTGCGTTTGTGACCTCACGTGACCTCACAATTTGAGTTTCCAGGAGTTTCCAGTAAGCTTTATTTCCAGCTTTATTTCCATTTTCTGCTATTTATTTTCTGCTATTTATGGCCTTTAATATGGCCTTTAATTCCTCTTATTTAGATTCGATTTAATGGGTTGGACACA

Full Affymetrix probeset data:

Annotations for 1641276_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720