FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641278_at:

>probe:Drosophila_2:1641278_at:448:605; Interrogation_Position=218; Antisense; TGATCTGTCCAAGCTTTACCATGTG
>probe:Drosophila_2:1641278_at:109:575; Interrogation_Position=251; Antisense; GGCGGCGGTCAACAAATCGTCTGAT
>probe:Drosophila_2:1641278_at:103:499; Interrogation_Position=269; Antisense; GTCTGATACCATCTTTCACGACGAT
>probe:Drosophila_2:1641278_at:597:577; Interrogation_Position=344; Antisense; GGCCAGAACGCTTTTGTCCAAGACG
>probe:Drosophila_2:1641278_at:443:407; Interrogation_Position=392; Antisense; GACGGAGCACATGAATCTGGCCAAA
>probe:Drosophila_2:1641278_at:62:337; Interrogation_Position=485; Antisense; GCTCCTTCAAGTGACCGCCATAAAA
>probe:Drosophila_2:1641278_at:568:591; Interrogation_Position=515; Antisense; TGGTGTCACCTATCAAGTCCCTGTT
>probe:Drosophila_2:1641278_at:290:379; Interrogation_Position=551; Antisense; GAAGCGGTCATATTTTCTGGCCATG
>probe:Drosophila_2:1641278_at:44:373; Interrogation_Position=575; Antisense; GAAGTGGCTCTTGGAAGCTGCCCGC
>probe:Drosophila_2:1641278_at:651:655; Interrogation_Position=611; Antisense; TAAGGTGTCCCTGCCGGAAAAGTTG
>probe:Drosophila_2:1641278_at:142:217; Interrogation_Position=630; Antisense; AAGTTGGCCTGGGAGATTCTCGACG
>probe:Drosophila_2:1641278_at:70:263; Interrogation_Position=655; Antisense; CAGCCCATGGCCAGGGAAGGGTCAT
>probe:Drosophila_2:1641278_at:675:169; Interrogation_Position=686; Antisense; AAAGGACGATCTGCACAGGCTGTGC
>probe:Drosophila_2:1641278_at:369:319; Interrogation_Position=721; Antisense; GCGCCTACGCACATTACCGATGGAG

Paste this into a BLAST search page for me
TGATCTGTCCAAGCTTTACCATGTGGGCGGCGGTCAACAAATCGTCTGATGTCTGATACCATCTTTCACGACGATGGCCAGAACGCTTTTGTCCAAGACGGACGGAGCACATGAATCTGGCCAAAGCTCCTTCAAGTGACCGCCATAAAATGGTGTCACCTATCAAGTCCCTGTTGAAGCGGTCATATTTTCTGGCCATGGAAGTGGCTCTTGGAAGCTGCCCGCTAAGGTGTCCCTGCCGGAAAAGTTGAAGTTGGCCTGGGAGATTCTCGACGCAGCCCATGGCCAGGGAAGGGTCATAAAGGACGATCTGCACAGGCTGTGCGCGCCTACGCACATTACCGATGGAG

Full Affymetrix probeset data:

Annotations for 1641278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720