Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641279_at:

>probe:Drosophila_2:1641279_at:673:465; Interrogation_Position=1323; Antisense; GATTGTATCATTTTCAGTGTTTCAG
>probe:Drosophila_2:1641279_at:631:213; Interrogation_Position=1355; Antisense; AAGATGTGATCGTCCAACTTGTAGA
>probe:Drosophila_2:1641279_at:388:627; Interrogation_Position=1367; Antisense; TCCAACTTGTAGACTTTACTTTTCT
>probe:Drosophila_2:1641279_at:484:213; Interrogation_Position=1397; Antisense; AAGAGTTCACCATTTCGATTGATAC
>probe:Drosophila_2:1641279_at:138:293; Interrogation_Position=1412; Antisense; CGATTGATACTTGAGCTTTGCCTGG
>probe:Drosophila_2:1641279_at:321:117; Interrogation_Position=1425; Antisense; AGCTTTGCCTGGGTTGTGTCAGAGT
>probe:Drosophila_2:1641279_at:511:541; Interrogation_Position=1436; Antisense; GGTTGTGTCAGAGTCCCTTTGATAA
>probe:Drosophila_2:1641279_at:313:259; Interrogation_Position=1444; Antisense; CAGAGTCCCTTTGATAAACGATAAA
>probe:Drosophila_2:1641279_at:553:659; Interrogation_Position=1496; Antisense; TAACCAAACAATGAAGCCTTTAAGC
>probe:Drosophila_2:1641279_at:52:83; Interrogation_Position=1659; Antisense; AGTGGCTTGATTGCGTGAAAATTTC
>probe:Drosophila_2:1641279_at:393:181; Interrogation_Position=1676; Antisense; AAAATTTCAAGTGCAGTTCTCAACA
>probe:Drosophila_2:1641279_at:397:509; Interrogation_Position=1686; Antisense; GTGCAGTTCTCAACAAAAATTGTGT
>probe:Drosophila_2:1641279_at:332:697; Interrogation_Position=1726; Antisense; TTGTCACCGAAATCACTAAAGGATA
>probe:Drosophila_2:1641279_at:612:25; Interrogation_Position=1763; Antisense; ATAGCAACCGAAAAGCAACCATAAA

Paste this into a BLAST search page for me
GATTGTATCATTTTCAGTGTTTCAGAAGATGTGATCGTCCAACTTGTAGATCCAACTTGTAGACTTTACTTTTCTAAGAGTTCACCATTTCGATTGATACCGATTGATACTTGAGCTTTGCCTGGAGCTTTGCCTGGGTTGTGTCAGAGTGGTTGTGTCAGAGTCCCTTTGATAACAGAGTCCCTTTGATAAACGATAAATAACCAAACAATGAAGCCTTTAAGCAGTGGCTTGATTGCGTGAAAATTTCAAAATTTCAAGTGCAGTTCTCAACAGTGCAGTTCTCAACAAAAATTGTGTTTGTCACCGAAATCACTAAAGGATAATAGCAACCGAAAAGCAACCATAAA

Full Affymetrix probeset data:

Annotations for 1641279_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime