FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641280_at:

>probe:Drosophila_2:1641280_at:350:627; Interrogation_Position=1371; Antisense; TCCACACGATTCTTAGTATTCCGCT
>probe:Drosophila_2:1641280_at:687:481; Interrogation_Position=1386; Antisense; GTATTCCGCTGTACTATGTGCACAC
>probe:Drosophila_2:1641280_at:504:513; Interrogation_Position=1415; Antisense; GTGATGCACGATCTTCTCAACGATA
>probe:Drosophila_2:1641280_at:125:457; Interrogation_Position=1436; Antisense; GATACTGTGGACATGGACACCGTGA
>probe:Drosophila_2:1641280_at:9:291; Interrogation_Position=1512; Antisense; CGGATCGCTCTGAAGGTGCCATTGA
>probe:Drosophila_2:1641280_at:484:601; Interrogation_Position=1534; Antisense; TGATTTCCCCTACAAGTTCTACGTG
>probe:Drosophila_2:1641280_at:69:473; Interrogation_Position=1549; Antisense; GTTCTACGTGAACATCGACCAGAGT
>probe:Drosophila_2:1641280_at:292:43; Interrogation_Position=1562; Antisense; ATCGACCAGAGTTTCCAGACTCAGA
>probe:Drosophila_2:1641280_at:202:265; Interrogation_Position=1613; Antisense; CAGTTCTATCGCGAGTTCTGCAAGA
>probe:Drosophila_2:1641280_at:319:277; Interrogation_Position=1675; Antisense; CTATGGAAGCTTGGCCGTTGGCAAT
>probe:Drosophila_2:1641280_at:237:231; Interrogation_Position=1711; Antisense; AATGATGTCATTGGGTTCTACGAAA
>probe:Drosophila_2:1641280_at:223:429; Interrogation_Position=1783; Antisense; GAGTAGCTTGGCTCTGCTGGAGTAC
>probe:Drosophila_2:1641280_at:498:331; Interrogation_Position=1798; Antisense; GCTGGAGTACTATCAACCTGTGTTG
>probe:Drosophila_2:1641280_at:659:253; Interrogation_Position=1811; Antisense; CAACCTGTGTTGGACTGGCTCAATA

Paste this into a BLAST search page for me
TCCACACGATTCTTAGTATTCCGCTGTATTCCGCTGTACTATGTGCACACGTGATGCACGATCTTCTCAACGATAGATACTGTGGACATGGACACCGTGACGGATCGCTCTGAAGGTGCCATTGATGATTTCCCCTACAAGTTCTACGTGGTTCTACGTGAACATCGACCAGAGTATCGACCAGAGTTTCCAGACTCAGACAGTTCTATCGCGAGTTCTGCAAGACTATGGAAGCTTGGCCGTTGGCAATAATGATGTCATTGGGTTCTACGAAAGAGTAGCTTGGCTCTGCTGGAGTACGCTGGAGTACTATCAACCTGTGTTGCAACCTGTGTTGGACTGGCTCAATA

Full Affymetrix probeset data:

Annotations for 1641280_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720