FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641281_at:

>probe:Drosophila_2:1641281_at:291:67; Interrogation_Position=1784; Antisense; ATGGCTTCATTTACGAGTGCAAGCG
>probe:Drosophila_2:1641281_at:96:113; Interrogation_Position=1832; Antisense; AGCAGCGACTGCAGCGTCACCAGGC
>probe:Drosophila_2:1641281_at:573:303; Interrogation_Position=1856; Antisense; CCGTCGGTTGTCAGCGGCACAAGGA
>probe:Drosophila_2:1641281_at:432:565; Interrogation_Position=1871; Antisense; GGCACAAGGAGGATAGCGTTCGCAT
>probe:Drosophila_2:1641281_at:275:115; Interrogation_Position=1904; Antisense; AGCAGTCGCGGTTCAAGCAGGAGTC
>probe:Drosophila_2:1641281_at:375:473; Interrogation_Position=1914; Antisense; GTTCAAGCAGGAGTCGCGCAGCAAG
>probe:Drosophila_2:1641281_at:18:351; Interrogation_Position=1931; Antisense; GCAGCAAGGACGACCGCCATCATGG
>probe:Drosophila_2:1641281_at:413:139; Interrogation_Position=1989; Antisense; ACGGGATCTTTTCAAGGCTGTGGCC
>probe:Drosophila_2:1641281_at:2:187; Interrogation_Position=2019; Antisense; AACAACCACCTATTGGAGCGATAGC
>probe:Drosophila_2:1641281_at:311:415; Interrogation_Position=2034; Antisense; GAGCGATAGCTTCTCGGACTAAAAA
>probe:Drosophila_2:1641281_at:702:169; Interrogation_Position=2056; Antisense; AAAAACCAAGGTGCGGCGGCTTGCG
>probe:Drosophila_2:1641281_at:40:575; Interrogation_Position=2070; Antisense; GGCGGCTTGCGGATTTCAATTCAAT
>probe:Drosophila_2:1641281_at:265:459; Interrogation_Position=2109; Antisense; GATTTTAAGTTTCTCTAGCTGTAGG
>probe:Drosophila_2:1641281_at:237:411; Interrogation_Position=2285; Antisense; GACGCTAAGATTTTCATTTGTTCCT

Paste this into a BLAST search page for me
ATGGCTTCATTTACGAGTGCAAGCGAGCAGCGACTGCAGCGTCACCAGGCCCGTCGGTTGTCAGCGGCACAAGGAGGCACAAGGAGGATAGCGTTCGCATAGCAGTCGCGGTTCAAGCAGGAGTCGTTCAAGCAGGAGTCGCGCAGCAAGGCAGCAAGGACGACCGCCATCATGGACGGGATCTTTTCAAGGCTGTGGCCAACAACCACCTATTGGAGCGATAGCGAGCGATAGCTTCTCGGACTAAAAAAAAAACCAAGGTGCGGCGGCTTGCGGGCGGCTTGCGGATTTCAATTCAATGATTTTAAGTTTCTCTAGCTGTAGGGACGCTAAGATTTTCATTTGTTCCT

Full Affymetrix probeset data:

Annotations for 1641281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720