FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641285_at:

>probe:Drosophila_2:1641285_at:129:235; Interrogation_Position=537; Antisense; AATCTTGAGTCGCATACCCGGCAAG
>probe:Drosophila_2:1641285_at:36:567; Interrogation_Position=556; Antisense; GGCAAGGGCCACTCAAAGCTCATAA
>probe:Drosophila_2:1641285_at:515:195; Interrogation_Position=579; Antisense; AACGGCTGGACTTGGATGGGCCACC
>probe:Drosophila_2:1641285_at:566:311; Interrogation_Position=604; Antisense; GCCGAAGTGATTCTTTCCCGAGGTA
>probe:Drosophila_2:1641285_at:345:73; Interrogation_Position=651; Antisense; AGGCACCGAGTTCAGTTGGATCTAC
>probe:Drosophila_2:1641285_at:301:545; Interrogation_Position=668; Antisense; GGATCTACATCCTCAAGTGTCTGGA
>probe:Drosophila_2:1641285_at:349:237; Interrogation_Position=692; Antisense; AATCGAACGTGCTTCTGGTGCAGCA
>probe:Drosophila_2:1641285_at:405:663; Interrogation_Position=773; Antisense; TAAAGCCGCTGGTTAGTCTACTTCT
>probe:Drosophila_2:1641285_at:164:669; Interrogation_Position=791; Antisense; TACTTCTGGCGGTGACTGTCTTCAA
>probe:Drosophila_2:1641285_at:435:151; Interrogation_Position=842; Antisense; ACATTCTGACCATTGGACCTTGGCT
>probe:Drosophila_2:1641285_at:626:411; Interrogation_Position=857; Antisense; GACCTTGGCTAACGGTGGCTGTTAA
>probe:Drosophila_2:1641285_at:651:521; Interrogation_Position=889; Antisense; GTGGCGGCCGTCATTGGATTCTGCA
>probe:Drosophila_2:1641285_at:339:135; Interrogation_Position=913; Antisense; ACGCTGCACATCTATTCGGGTCTGG
>probe:Drosophila_2:1641285_at:65:599; Interrogation_Position=963; Antisense; TGTGCCAAACACTCTGTATTCCTTT

Paste this into a BLAST search page for me
AATCTTGAGTCGCATACCCGGCAAGGGCAAGGGCCACTCAAAGCTCATAAAACGGCTGGACTTGGATGGGCCACCGCCGAAGTGATTCTTTCCCGAGGTAAGGCACCGAGTTCAGTTGGATCTACGGATCTACATCCTCAAGTGTCTGGAAATCGAACGTGCTTCTGGTGCAGCATAAAGCCGCTGGTTAGTCTACTTCTTACTTCTGGCGGTGACTGTCTTCAAACATTCTGACCATTGGACCTTGGCTGACCTTGGCTAACGGTGGCTGTTAAGTGGCGGCCGTCATTGGATTCTGCAACGCTGCACATCTATTCGGGTCTGGTGTGCCAAACACTCTGTATTCCTTT

Full Affymetrix probeset data:

Annotations for 1641285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720