Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641287_at:

>probe:Drosophila_2:1641287_at:412:127; Interrogation_Position=2453; Antisense; ACCAGCCTCTGGACGATCTGATCAA
>probe:Drosophila_2:1641287_at:384:189; Interrogation_Position=2476; Antisense; AACATTGTGATTTCCTAACCAAGTG
>probe:Drosophila_2:1641287_at:442:345; Interrogation_Position=2513; Antisense; GCATAGATTTCTGTTGTAGCCAAGC
>probe:Drosophila_2:1641287_at:217:587; Interrogation_Position=2561; Antisense; TGGAGCGTAGCTCCCGAAACTCAAG
>probe:Drosophila_2:1641287_at:104:391; Interrogation_Position=2576; Antisense; GAAACTCAAGCTTACATAGACCATA
>probe:Drosophila_2:1641287_at:230:541; Interrogation_Position=2611; Antisense; GGATATTCCGTAGGGCATAAACCAT
>probe:Drosophila_2:1641287_at:32:677; Interrogation_Position=2637; Antisense; TAGCTATATCTCTGTCCATTTCTTC
>probe:Drosophila_2:1641287_at:262:271; Interrogation_Position=2653; Antisense; CATTTCTTCGATCGGTCCCTAAGGC
>probe:Drosophila_2:1641287_at:395:345; Interrogation_Position=2687; Antisense; GCATATCTCTTTCTAACTCTGAGCC
>probe:Drosophila_2:1641287_at:276:315; Interrogation_Position=2709; Antisense; GCCATATTAATCTCACAGAACGCCT
>probe:Drosophila_2:1641287_at:19:107; Interrogation_Position=2725; Antisense; AGAACGCCTTTAAACACTACCAGCA
>probe:Drosophila_2:1641287_at:487:21; Interrogation_Position=2759; Antisense; ATATATCCATTTGACCACTTAGCGA
>probe:Drosophila_2:1641287_at:623:421; Interrogation_Position=2821; Antisense; GAGCAATCTAAGCTTCGCGGCGAAC
>probe:Drosophila_2:1641287_at:381:633; Interrogation_Position=2835; Antisense; TCGCGGCGAACTTTTAATGCTCAAG

Paste this into a BLAST search page for me
ACCAGCCTCTGGACGATCTGATCAAAACATTGTGATTTCCTAACCAAGTGGCATAGATTTCTGTTGTAGCCAAGCTGGAGCGTAGCTCCCGAAACTCAAGGAAACTCAAGCTTACATAGACCATAGGATATTCCGTAGGGCATAAACCATTAGCTATATCTCTGTCCATTTCTTCCATTTCTTCGATCGGTCCCTAAGGCGCATATCTCTTTCTAACTCTGAGCCGCCATATTAATCTCACAGAACGCCTAGAACGCCTTTAAACACTACCAGCAATATATCCATTTGACCACTTAGCGAGAGCAATCTAAGCTTCGCGGCGAACTCGCGGCGAACTTTTAATGCTCAAG

Full Affymetrix probeset data:

Annotations for 1641287_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime