FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641288_at:

>probe:Drosophila_2:1641288_at:722:565; Interrogation_Position=110; Antisense; GGCAAGACTTTCAGGAGTGTCTACA
>probe:Drosophila_2:1641288_at:625:393; Interrogation_Position=165; Antisense; GAAATACGCGCGACACGAAACTTTG
>probe:Drosophila_2:1641288_at:181:391; Interrogation_Position=181; Antisense; GAAACTTTGGATTACCTGCTCAACG
>probe:Drosophila_2:1641288_at:347:403; Interrogation_Position=26; Antisense; GACTTGTATTTATTGCGCCTCTGAT
>probe:Drosophila_2:1641288_at:110:363; Interrogation_Position=306; Antisense; GAATACGACCGATAAGGCATCCAAA
>probe:Drosophila_2:1641288_at:674:71; Interrogation_Position=320; Antisense; AGGCATCCAAATCCATTACCAAGTG
>probe:Drosophila_2:1641288_at:135:221; Interrogation_Position=352; Antisense; AAGGCTCCCGAAGAACTTTGTGCGT
>probe:Drosophila_2:1641288_at:10:385; Interrogation_Position=364; Antisense; GAACTTTGTGCGTACAGTTTTAGAC
>probe:Drosophila_2:1641288_at:429:477; Interrogation_Position=380; Antisense; GTTTTAGACTGGTGATGTGTGCATT
>probe:Drosophila_2:1641288_at:117:625; Interrogation_Position=39; Antisense; TGCGCCTCTGATTTTGTTATTGTTC
>probe:Drosophila_2:1641288_at:123:597; Interrogation_Position=395; Antisense; TGTGTGCATTTAAGGCTGGCCATCC
>probe:Drosophila_2:1641288_at:261:285; Interrogation_Position=410; Antisense; CTGGCCATCCCGTAATTGATTCGGA
>probe:Drosophila_2:1641288_at:588:475; Interrogation_Position=54; Antisense; GTTATTGTTCAGCTTGGCCAAGGCT
>probe:Drosophila_2:1641288_at:197:635; Interrogation_Position=78; Antisense; TCGCCACCCCTTTGATATATTTCAT

Paste this into a BLAST search page for me
GGCAAGACTTTCAGGAGTGTCTACAGAAATACGCGCGACACGAAACTTTGGAAACTTTGGATTACCTGCTCAACGGACTTGTATTTATTGCGCCTCTGATGAATACGACCGATAAGGCATCCAAAAGGCATCCAAATCCATTACCAAGTGAAGGCTCCCGAAGAACTTTGTGCGTGAACTTTGTGCGTACAGTTTTAGACGTTTTAGACTGGTGATGTGTGCATTTGCGCCTCTGATTTTGTTATTGTTCTGTGTGCATTTAAGGCTGGCCATCCCTGGCCATCCCGTAATTGATTCGGAGTTATTGTTCAGCTTGGCCAAGGCTTCGCCACCCCTTTGATATATTTCAT

Full Affymetrix probeset data:

Annotations for 1641288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720