Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641290_at:

>probe:Drosophila_2:1641290_at:78:659; Interrogation_Position=1568; Antisense; TAACCTAACCAATCTGACGGATGAT
>probe:Drosophila_2:1641290_at:234:451; Interrogation_Position=1590; Antisense; GATCGCAGCGTCTGGAAGTTTGCCG
>probe:Drosophila_2:1641290_at:48:485; Interrogation_Position=1637; Antisense; GTATGTGTGGCTTCATCTGGACGAT
>probe:Drosophila_2:1641290_at:490:585; Interrogation_Position=1654; Antisense; TGGACGATGTGCTGGCCCAAGTCAG
>probe:Drosophila_2:1641290_at:98:651; Interrogation_Position=1675; Antisense; TCAGCGATCCCGAGGAGCAGCAACA
>probe:Drosophila_2:1641290_at:102:511; Interrogation_Position=1729; Antisense; GTGACGATCTGGACCGTGAGCAACA
>probe:Drosophila_2:1641290_at:14:607; Interrogation_Position=1745; Antisense; TGAGCAACAGCCACTTGTTCCACTG
>probe:Drosophila_2:1641290_at:420:627; Interrogation_Position=1768; Antisense; TGCCTCCGAAGCCAGTATCATGATC
>probe:Drosophila_2:1641290_at:112:273; Interrogation_Position=1792; Antisense; CATTACAGCTAAGGTTTGTCTCGTA
>probe:Drosophila_2:1641290_at:558:599; Interrogation_Position=1808; Antisense; TGTCTCGTATTGTTGGTTCGTGTAG
>probe:Drosophila_2:1641290_at:176:541; Interrogation_Position=1822; Antisense; GGTTCGTGTAGTGCTCCAAAGATTA
>probe:Drosophila_2:1641290_at:650:195; Interrogation_Position=1906; Antisense; AACGGTTGGTGGCTGTATGCTTATC
>probe:Drosophila_2:1641290_at:115:87; Interrogation_Position=1978; Antisense; AGTGCCCCAAAATGCTGTTGTCTGT
>probe:Drosophila_2:1641290_at:339:499; Interrogation_Position=1997; Antisense; GTCTGTGGATATACTTCCTGTAGCT

Paste this into a BLAST search page for me
TAACCTAACCAATCTGACGGATGATGATCGCAGCGTCTGGAAGTTTGCCGGTATGTGTGGCTTCATCTGGACGATTGGACGATGTGCTGGCCCAAGTCAGTCAGCGATCCCGAGGAGCAGCAACAGTGACGATCTGGACCGTGAGCAACATGAGCAACAGCCACTTGTTCCACTGTGCCTCCGAAGCCAGTATCATGATCCATTACAGCTAAGGTTTGTCTCGTATGTCTCGTATTGTTGGTTCGTGTAGGGTTCGTGTAGTGCTCCAAAGATTAAACGGTTGGTGGCTGTATGCTTATCAGTGCCCCAAAATGCTGTTGTCTGTGTCTGTGGATATACTTCCTGTAGCT

Full Affymetrix probeset data:

Annotations for 1641290_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime