FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641291_at:

>probe:Drosophila_2:1641291_at:286:85; Interrogation_Position=1449; Antisense; AGTGTAGTCTACACGCATCCCGAGG
>probe:Drosophila_2:1641291_at:237:251; Interrogation_Position=1574; Antisense; CAACGACACCGACGGTTTCGTCAAG
>probe:Drosophila_2:1641291_at:92:695; Interrogation_Position=1589; Antisense; TTTCGTCAAGGTTCTGGCCGACCAG
>probe:Drosophila_2:1641291_at:539:55; Interrogation_Position=1612; Antisense; AGGCCACCGATAAGATCCTGGGAAC
>probe:Drosophila_2:1641291_at:520:279; Interrogation_Position=1629; Antisense; CTGGGAACCCATATTATCGGACCTG
>probe:Drosophila_2:1641291_at:31:593; Interrogation_Position=1652; Antisense; TGGTGCCGGCGAGCTCATTAACGAG
>probe:Drosophila_2:1641291_at:501:709; Interrogation_Position=1669; Antisense; TTAACGAGGCTGTGCTGGCCATGGA
>probe:Drosophila_2:1641291_at:45:481; Interrogation_Position=1725; Antisense; GTTTGCCATGCGCATCCAACATGTT
>probe:Drosophila_2:1641291_at:574:189; Interrogation_Position=1742; Antisense; AACATGTTCCGAGGCCCTGCGTGAG
>probe:Drosophila_2:1641291_at:258:513; Interrogation_Position=1762; Antisense; GTGAGGCCAATGTGGCAGCTGCCTT
>probe:Drosophila_2:1641291_at:340:583; Interrogation_Position=1787; Antisense; TGGCAAACCCATCAACTTCTAAGCA
>probe:Drosophila_2:1641291_at:546:371; Interrogation_Position=1835; Antisense; GAAGAATTTTGCACCGCGTTTGAAA
>probe:Drosophila_2:1641291_at:162:391; Interrogation_Position=1900; Antisense; GAAACGACAGTCTCCGCATATTTGT
>probe:Drosophila_2:1641291_at:262:323; Interrogation_Position=1974; Antisense; GCGCCAGGCGTTAATTGCAATGTAA

Paste this into a BLAST search page for me
AGTGTAGTCTACACGCATCCCGAGGCAACGACACCGACGGTTTCGTCAAGTTTCGTCAAGGTTCTGGCCGACCAGAGGCCACCGATAAGATCCTGGGAACCTGGGAACCCATATTATCGGACCTGTGGTGCCGGCGAGCTCATTAACGAGTTAACGAGGCTGTGCTGGCCATGGAGTTTGCCATGCGCATCCAACATGTTAACATGTTCCGAGGCCCTGCGTGAGGTGAGGCCAATGTGGCAGCTGCCTTTGGCAAACCCATCAACTTCTAAGCAGAAGAATTTTGCACCGCGTTTGAAAGAAACGACAGTCTCCGCATATTTGTGCGCCAGGCGTTAATTGCAATGTAA

Full Affymetrix probeset data:

Annotations for 1641291_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720