FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641292_at:

>probe:Drosophila_2:1641292_at:355:543; Interrogation_Position=280; Antisense; GGATTCCTGCTCGAAGTCTGTGAAA
>probe:Drosophila_2:1641292_at:122:239; Interrogation_Position=310; Antisense; AATCACCCGCAGTACAATTGCTGGC
>probe:Drosophila_2:1641292_at:644:143; Interrogation_Position=354; Antisense; ACTGTTGAAGTTGTGCGATCCGCTC
>probe:Drosophila_2:1641292_at:537:689; Interrogation_Position=393; Antisense; TATTCAGCCCATCAGCATAGCAGAG
>probe:Drosophila_2:1641292_at:51:139; Interrogation_Position=428; Antisense; ACGATGGTTCGTGGTGCACTGTCTC
>probe:Drosophila_2:1641292_at:7:69; Interrogation_Position=526; Antisense; ATGGCATGGGTCAGCGTCTACAATC
>probe:Drosophila_2:1641292_at:714:601; Interrogation_Position=576; Antisense; TGTTTGGTTCGGACTCTGGGACAAT
>probe:Drosophila_2:1641292_at:471:591; Interrogation_Position=592; Antisense; TGGGACAATGGCATCTCGTACCTTA
>probe:Drosophila_2:1641292_at:203:33; Interrogation_Position=629; Antisense; ATAATGGCGCCGGAGGATGCTCCTA
>probe:Drosophila_2:1641292_at:212:141; Interrogation_Position=658; Antisense; ACGGGAGCTCCCTTGGTGATAGATG
>probe:Drosophila_2:1641292_at:235:441; Interrogation_Position=679; Antisense; GATGGACAACTCGTGGGCATTCTAT
>probe:Drosophila_2:1641292_at:493:517; Interrogation_Position=691; Antisense; GTGGGCATTCTATCCGAAGGCGGCT
>probe:Drosophila_2:1641292_at:406:443; Interrogation_Position=730; Antisense; GATGTCTACGCCAATGTACCTTGGT
>probe:Drosophila_2:1641292_at:195:445; Interrogation_Position=784; Antisense; GATGAGGATACAACCGCTTCGACAA

Paste this into a BLAST search page for me
GGATTCCTGCTCGAAGTCTGTGAAAAATCACCCGCAGTACAATTGCTGGCACTGTTGAAGTTGTGCGATCCGCTCTATTCAGCCCATCAGCATAGCAGAGACGATGGTTCGTGGTGCACTGTCTCATGGCATGGGTCAGCGTCTACAATCTGTTTGGTTCGGACTCTGGGACAATTGGGACAATGGCATCTCGTACCTTAATAATGGCGCCGGAGGATGCTCCTAACGGGAGCTCCCTTGGTGATAGATGGATGGACAACTCGTGGGCATTCTATGTGGGCATTCTATCCGAAGGCGGCTGATGTCTACGCCAATGTACCTTGGTGATGAGGATACAACCGCTTCGACAA

Full Affymetrix probeset data:

Annotations for 1641292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720