FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641293_at:

>probe:Drosophila_2:1641293_at:1:85; Interrogation_Position=2530; Antisense; AGTGTACGAGATTTGCTCCGTGCTC
>probe:Drosophila_2:1641293_at:431:345; Interrogation_Position=2568; Antisense; GCATCATTATCACGAGCTAACGCCA
>probe:Drosophila_2:1641293_at:271:447; Interrogation_Position=2604; Antisense; GATGCTGGGCTGCATTCCGCACGAA
>probe:Drosophila_2:1641293_at:34:689; Interrogation_Position=2711; Antisense; TATTCAAGCCTTACTACAGTGCCGG
>probe:Drosophila_2:1641293_at:137:85; Interrogation_Position=2728; Antisense; AGTGCCGGCTATCTTTTTACACGTC
>probe:Drosophila_2:1641293_at:707:651; Interrogation_Position=2745; Antisense; TACACGTCCGTGGTACTTTGATGCG
>probe:Drosophila_2:1641293_at:652:333; Interrogation_Position=2778; Antisense; GCTGTTTCCCATGCTGATGCTGGAT
>probe:Drosophila_2:1641293_at:230:203; Interrogation_Position=2806; Antisense; AAGCCCCTGCCCAAGATTGGTAGTC
>probe:Drosophila_2:1641293_at:536:661; Interrogation_Position=2832; Antisense; TAAAAAGACACCTTCGCCGGCAAGC
>probe:Drosophila_2:1641293_at:374:581; Interrogation_Position=2931; Antisense; TGGCGTTGGTCTGCAGCGTAATCTA
>probe:Drosophila_2:1641293_at:640:677; Interrogation_Position=2960; Antisense; TAGATGGACAATCACTGGAGCCCGA
>probe:Drosophila_2:1641293_at:155:661; Interrogation_Position=3006; Antisense; TAACTTTAAGTTTCGGCGCTACTCG
>probe:Drosophila_2:1641293_at:29:45; Interrogation_Position=3044; Antisense; ATCGCAATTACAACGGTGGGCACAA
>probe:Drosophila_2:1641293_at:728:217; Interrogation_Position=3088; Antisense; AAGTACGTAATCTGGACGCTGCCAC

Paste this into a BLAST search page for me
AGTGTACGAGATTTGCTCCGTGCTCGCATCATTATCACGAGCTAACGCCAGATGCTGGGCTGCATTCCGCACGAATATTCAAGCCTTACTACAGTGCCGGAGTGCCGGCTATCTTTTTACACGTCTACACGTCCGTGGTACTTTGATGCGGCTGTTTCCCATGCTGATGCTGGATAAGCCCCTGCCCAAGATTGGTAGTCTAAAAAGACACCTTCGCCGGCAAGCTGGCGTTGGTCTGCAGCGTAATCTATAGATGGACAATCACTGGAGCCCGATAACTTTAAGTTTCGGCGCTACTCGATCGCAATTACAACGGTGGGCACAAAAGTACGTAATCTGGACGCTGCCAC

Full Affymetrix probeset data:

Annotations for 1641293_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720