Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641294_a_at:

>probe:Drosophila_2:1641294_a_at:483:25; Interrogation_Position=1108; Antisense; ATAGCCGTAGTTTCCATTGAGCGCG
>probe:Drosophila_2:1641294_a_at:124:323; Interrogation_Position=1130; Antisense; GCGCGCGTCTTTCGATAAGTTTACT
>probe:Drosophila_2:1641294_a_at:585:233; Interrogation_Position=1174; Antisense; AATGCCTTCTCGATTAAACTTCTCA
>probe:Drosophila_2:1641294_a_at:275:209; Interrogation_Position=1203; Antisense; AAGCACACTGATTCAACGCCATCTT
>probe:Drosophila_2:1641294_a_at:58:135; Interrogation_Position=1218; Antisense; ACGCCATCTTTGAATACCACTGTTA
>probe:Drosophila_2:1641294_a_at:705:637; Interrogation_Position=682; Antisense; TCGTTGGATTCACGCTGTCACTTTA
>probe:Drosophila_2:1641294_a_at:477:285; Interrogation_Position=696; Antisense; CTGTCACTTTACCTGCTGGGCGAGT
>probe:Drosophila_2:1641294_a_at:481:585; Interrogation_Position=712; Antisense; TGGGCGAGTTCCTCAACAATACCGT
>probe:Drosophila_2:1641294_a_at:253:253; Interrogation_Position=725; Antisense; CAACAATACCGTCTGGGCCAAGGAA
>probe:Drosophila_2:1641294_a_at:38:579; Interrogation_Position=758; Antisense; GGCCAAGCGCAAATCCAACTAGGAG
>probe:Drosophila_2:1641294_a_at:128:1; Interrogation_Position=774; Antisense; AACTAGGAGGCTGTGACCCGTTTCT
>probe:Drosophila_2:1641294_a_at:459:133; Interrogation_Position=789; Antisense; ACCCGTTTCTGTTCGATGTAGTTGC
>probe:Drosophila_2:1641294_a_at:339:535; Interrogation_Position=849; Antisense; GGTCTCGATTATACATTTTGCTCAT
>probe:Drosophila_2:1641294_a_at:615:645; Interrogation_Position=870; Antisense; TCATATTGTTCGATCTTCTCAGCCA

Paste this into a BLAST search page for me
ATAGCCGTAGTTTCCATTGAGCGCGGCGCGCGTCTTTCGATAAGTTTACTAATGCCTTCTCGATTAAACTTCTCAAAGCACACTGATTCAACGCCATCTTACGCCATCTTTGAATACCACTGTTATCGTTGGATTCACGCTGTCACTTTACTGTCACTTTACCTGCTGGGCGAGTTGGGCGAGTTCCTCAACAATACCGTCAACAATACCGTCTGGGCCAAGGAAGGCCAAGCGCAAATCCAACTAGGAGAACTAGGAGGCTGTGACCCGTTTCTACCCGTTTCTGTTCGATGTAGTTGCGGTCTCGATTATACATTTTGCTCATTCATATTGTTCGATCTTCTCAGCCA

Full Affymetrix probeset data:

Annotations for 1641294_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime