FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641297_at:

>probe:Drosophila_2:1641297_at:49:459; Interrogation_Position=8538; Antisense; GATTTGGTTTACTTCTGGACCGGCT
>probe:Drosophila_2:1641297_at:455:275; Interrogation_Position=8571; Antisense; CTTCCAGCTTCGGAGGAGGGATTCC
>probe:Drosophila_2:1641297_at:218:435; Interrogation_Position=8586; Antisense; GAGGGATTCCAACCATTGCCATCTG
>probe:Drosophila_2:1641297_at:96:723; Interrogation_Position=8601; Antisense; TTGCCATCTGTCACCATAAGACCTG
>probe:Drosophila_2:1641297_at:425:31; Interrogation_Position=8616; Antisense; ATAAGACCTGCGGATGACTCCCATC
>probe:Drosophila_2:1641297_at:40:307; Interrogation_Position=8636; Antisense; CCATCTACCGACTGCGAATACTTGT
>probe:Drosophila_2:1641297_at:324:667; Interrogation_Position=8654; Antisense; TACTTGTATCTCTCGGCTGTATATC
>probe:Drosophila_2:1641297_at:471:687; Interrogation_Position=8673; Antisense; TATATCCCTCTTTACTCCAGCAAAT
>probe:Drosophila_2:1641297_at:123:327; Interrogation_Position=8757; Antisense; GCGATTGGAAGTCTTTCCCATCTGT
>probe:Drosophila_2:1641297_at:227:429; Interrogation_Position=8825; Antisense; GAGTTTCGACTTTCGTCATATTTAA
>probe:Drosophila_2:1641297_at:70:681; Interrogation_Position=8843; Antisense; TATTTAACCATACCATTCCCATTTC
>probe:Drosophila_2:1641297_at:103:95; Interrogation_Position=8930; Antisense; AGATTGGCTCGGGTCATGACGGTCT
>probe:Drosophila_2:1641297_at:4:645; Interrogation_Position=8952; Antisense; TCTTGCTTGACCCAACGTGTAGTAA
>probe:Drosophila_2:1641297_at:339:613; Interrogation_Position=8982; Antisense; TGAAACTCCCCAACATCCATTGTAA

Paste this into a BLAST search page for me
GATTTGGTTTACTTCTGGACCGGCTCTTCCAGCTTCGGAGGAGGGATTCCGAGGGATTCCAACCATTGCCATCTGTTGCCATCTGTCACCATAAGACCTGATAAGACCTGCGGATGACTCCCATCCCATCTACCGACTGCGAATACTTGTTACTTGTATCTCTCGGCTGTATATCTATATCCCTCTTTACTCCAGCAAATGCGATTGGAAGTCTTTCCCATCTGTGAGTTTCGACTTTCGTCATATTTAATATTTAACCATACCATTCCCATTTCAGATTGGCTCGGGTCATGACGGTCTTCTTGCTTGACCCAACGTGTAGTAATGAAACTCCCCAACATCCATTGTAA

Full Affymetrix probeset data:

Annotations for 1641297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720