Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641298_at:

>probe:Drosophila_2:1641298_at:260:411; Interrogation_Position=3382; Antisense; GACGCAAGCACGAACGCAAGCTGTT
>probe:Drosophila_2:1641298_at:297:203; Interrogation_Position=3462; Antisense; AACCACGTCACGAAGATAGCCCAAC
>probe:Drosophila_2:1641298_at:661:111; Interrogation_Position=3490; Antisense; AGCAGCCTGTGCGTGACACATGCAA
>probe:Drosophila_2:1641298_at:136:613; Interrogation_Position=3503; Antisense; TGACACATGCAAAGCGCTCCTACAG
>probe:Drosophila_2:1641298_at:195:125; Interrogation_Position=3560; Antisense; AGCCGCACTGCAGCGTGAATTCAAG
>probe:Drosophila_2:1641298_at:172:557; Interrogation_Position=3614; Antisense; GGACGAGATCTGGACACCTGAGCTA
>probe:Drosophila_2:1641298_at:106:607; Interrogation_Position=3652; Antisense; TGATGGCGGATCACCTTACGGGACC
>probe:Drosophila_2:1641298_at:618:63; Interrogation_Position=3679; Antisense; ATGTGGATTACCTTGCACTGCAGAA
>probe:Drosophila_2:1641298_at:730:223; Interrogation_Position=3702; Antisense; AAGGAGCAGCGCTATGCCTTGCTAA
>probe:Drosophila_2:1641298_at:330:205; Interrogation_Position=3744; Antisense; AAGCCGCAGCTGATTATGATGGACT
>probe:Drosophila_2:1641298_at:254:67; Interrogation_Position=3762; Antisense; ATGGACTGGCAACACGAGATCCTCC
>probe:Drosophila_2:1641298_at:351:449; Interrogation_Position=3779; Antisense; GATCCTCCAGTGAATCTTCGACGGG
>probe:Drosophila_2:1641298_at:273:545; Interrogation_Position=3802; Antisense; GGATCATTGGATTTGCGTGCTGCAC
>probe:Drosophila_2:1641298_at:535:645; Interrogation_Position=3854; Antisense; TCAGTCTCCCACTTTTGTTAACTTT

Paste this into a BLAST search page for me
GACGCAAGCACGAACGCAAGCTGTTAACCACGTCACGAAGATAGCCCAACAGCAGCCTGTGCGTGACACATGCAATGACACATGCAAAGCGCTCCTACAGAGCCGCACTGCAGCGTGAATTCAAGGGACGAGATCTGGACACCTGAGCTATGATGGCGGATCACCTTACGGGACCATGTGGATTACCTTGCACTGCAGAAAAGGAGCAGCGCTATGCCTTGCTAAAAGCCGCAGCTGATTATGATGGACTATGGACTGGCAACACGAGATCCTCCGATCCTCCAGTGAATCTTCGACGGGGGATCATTGGATTTGCGTGCTGCACTCAGTCTCCCACTTTTGTTAACTTT

Full Affymetrix probeset data:

Annotations for 1641298_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime