FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641301_at:

>probe:Drosophila_2:1641301_at:318:545; Interrogation_Position=117; Antisense; GGATCCTGGCTCCAAACTCAAAGAG
>probe:Drosophila_2:1641301_at:433:193; Interrogation_Position=131; Antisense; AACTCAAAGAGAGCTTCCACACGGA
>probe:Drosophila_2:1641301_at:573:211; Interrogation_Position=211; Antisense; AAGAAACTGAGCAGCTCCCTGACTT
>probe:Drosophila_2:1641301_at:118:615; Interrogation_Position=251; Antisense; TGAATCAGGAGAAGCGCACTCGCAT
>probe:Drosophila_2:1641301_at:265:49; Interrogation_Position=283; Antisense; ATCCAGCTGCATTGTCGCGGCAAAT
>probe:Drosophila_2:1641301_at:186:567; Interrogation_Position=301; Antisense; GGCAAATTGCGACCCAAGGAGACCC
>probe:Drosophila_2:1641301_at:378:75; Interrogation_Position=317; Antisense; AGGAGACCCAATCCTTTGAGGCCGA
>probe:Drosophila_2:1641301_at:678:167; Interrogation_Position=432; Antisense; AAATGTGATAGCAGCACCTCCACAA
>probe:Drosophila_2:1641301_at:641:383; Interrogation_Position=480; Antisense; GAACATGGACACCATCCAGAAGCTA
>probe:Drosophila_2:1641301_at:707:307; Interrogation_Position=495; Antisense; CCAGAAGCTAAATGCCCTCACGGAG
>probe:Drosophila_2:1641301_at:297:505; Interrogation_Position=549; Antisense; GTCCAGTCTGATCACAGAACGCGGT
>probe:Drosophila_2:1641301_at:188:31; Interrogation_Position=56; Antisense; ATACAATGAGCAGGACCGCCCATAT
>probe:Drosophila_2:1641301_at:9:383; Interrogation_Position=565; Antisense; GAACGCGGTGCAGTGAGAGCCTTAA
>probe:Drosophila_2:1641301_at:8:161; Interrogation_Position=92; Antisense; ACAATGGGACTGTGGTCCGCCGGAC

Paste this into a BLAST search page for me
GGATCCTGGCTCCAAACTCAAAGAGAACTCAAAGAGAGCTTCCACACGGAAAGAAACTGAGCAGCTCCCTGACTTTGAATCAGGAGAAGCGCACTCGCATATCCAGCTGCATTGTCGCGGCAAATGGCAAATTGCGACCCAAGGAGACCCAGGAGACCCAATCCTTTGAGGCCGAAAATGTGATAGCAGCACCTCCACAAGAACATGGACACCATCCAGAAGCTACCAGAAGCTAAATGCCCTCACGGAGGTCCAGTCTGATCACAGAACGCGGTATACAATGAGCAGGACCGCCCATATGAACGCGGTGCAGTGAGAGCCTTAAACAATGGGACTGTGGTCCGCCGGAC

Full Affymetrix probeset data:

Annotations for 1641301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720