FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641302_at:

>probe:Drosophila_2:1641302_at:462:477; Interrogation_Position=336; Antisense; GTTTCAATGATGTTACTGCCTTCGG
>probe:Drosophila_2:1641302_at:642:61; Interrogation_Position=376; Antisense; ATGTCTATCCGCTACAAAATGCCGC
>probe:Drosophila_2:1641302_at:129:517; Interrogation_Position=481; Antisense; GTGGCGTAGGAGCAACATCCAACCC
>probe:Drosophila_2:1641302_at:460:205; Interrogation_Position=507; Antisense; AAGCCCTTGCTACTGACACGAACAT
>probe:Drosophila_2:1641302_at:77:385; Interrogation_Position=526; Antisense; GAACATCATCGCCTCAATTGACAAC
>probe:Drosophila_2:1641302_at:344:169; Interrogation_Position=563; Antisense; AAATGGCTCTGTTGTCCATGCCACG
>probe:Drosophila_2:1641302_at:499:195; Interrogation_Position=600; Antisense; AACGGATGTCCGTTGACCCAATCCT
>probe:Drosophila_2:1641302_at:168:235; Interrogation_Position=619; Antisense; AATCCTCCGGAATCCCAGTGACAAT
>probe:Drosophila_2:1641302_at:325:43; Interrogation_Position=716; Antisense; ATCGACGGAGCTGAGCACTGGGTTA
>probe:Drosophila_2:1641302_at:658:165; Interrogation_Position=743; Antisense; AAATGAAACTAACTGCGGCACCGGG
>probe:Drosophila_2:1641302_at:439:415; Interrogation_Position=767; Antisense; GATCTATGGGCCACTTTTGGGTCAA
>probe:Drosophila_2:1641302_at:346:575; Interrogation_Position=801; Antisense; GGCGTCATCGCTGGCATGACCGAAA
>probe:Drosophila_2:1641302_at:513:585; Interrogation_Position=842; Antisense; TGGACACTTGGAGGCCATACAGGAA
>probe:Drosophila_2:1641302_at:97:653; Interrogation_Position=871; Antisense; TCAAGCCCGGCTGGAGTGTTCATGT

Paste this into a BLAST search page for me
GTTTCAATGATGTTACTGCCTTCGGATGTCTATCCGCTACAAAATGCCGCGTGGCGTAGGAGCAACATCCAACCCAAGCCCTTGCTACTGACACGAACATGAACATCATCGCCTCAATTGACAACAAATGGCTCTGTTGTCCATGCCACGAACGGATGTCCGTTGACCCAATCCTAATCCTCCGGAATCCCAGTGACAATATCGACGGAGCTGAGCACTGGGTTAAAATGAAACTAACTGCGGCACCGGGGATCTATGGGCCACTTTTGGGTCAAGGCGTCATCGCTGGCATGACCGAAATGGACACTTGGAGGCCATACAGGAATCAAGCCCGGCTGGAGTGTTCATGT

Full Affymetrix probeset data:

Annotations for 1641302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720