Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641303_at:

>probe:Drosophila_2:1641303_at:188:307; Interrogation_Position=3993; Antisense; CCTCGACGCTTAACGACTTTGCAAT
>probe:Drosophila_2:1641303_at:694:403; Interrogation_Position=4007; Antisense; GACTTTGCAATAACTTTCATACCAA
>probe:Drosophila_2:1641303_at:112:687; Interrogation_Position=4043; Antisense; TATATTTTGTGCCTAGATGTTGAAC
>probe:Drosophila_2:1641303_at:632:675; Interrogation_Position=4093; Antisense; TAGCAATTGTTAACTACTCGCCCCG
>probe:Drosophila_2:1641303_at:656:43; Interrogation_Position=4147; Antisense; ATCGACAAATCGTGGCAATGCAATC
>probe:Drosophila_2:1641303_at:386:565; Interrogation_Position=4160; Antisense; GGCAATGCAATCTTACCGAATCCCT
>probe:Drosophila_2:1641303_at:707:131; Interrogation_Position=4174; Antisense; ACCGAATCCCTCTTCTCAGAAAATG
>probe:Drosophila_2:1641303_at:419:227; Interrogation_Position=4195; Antisense; AATGTCTACGGACCTGAGATTCTGA
>probe:Drosophila_2:1641303_at:616:95; Interrogation_Position=4211; Antisense; AGATTCTGAGTGGAGTTCGATGAGC
>probe:Drosophila_2:1641303_at:197:421; Interrogation_Position=4232; Antisense; GAGCAGCTCCAAACAAAACTAAAAT
>probe:Drosophila_2:1641303_at:530:245; Interrogation_Position=4254; Antisense; AATTAAATCTGCGTTGGACCAATGT
>probe:Drosophila_2:1641303_at:723:227; Interrogation_Position=4304; Antisense; AATGCAGTTTTCTAGAGGTTTCCTA
>probe:Drosophila_2:1641303_at:323:539; Interrogation_Position=4320; Antisense; GGTTTCCTAATATCTTTGTCGCCAT
>probe:Drosophila_2:1641303_at:101:503; Interrogation_Position=4337; Antisense; GTCGCCATATCGGAAGAGAACTTAT

Paste this into a BLAST search page for me
CCTCGACGCTTAACGACTTTGCAATGACTTTGCAATAACTTTCATACCAATATATTTTGTGCCTAGATGTTGAACTAGCAATTGTTAACTACTCGCCCCGATCGACAAATCGTGGCAATGCAATCGGCAATGCAATCTTACCGAATCCCTACCGAATCCCTCTTCTCAGAAAATGAATGTCTACGGACCTGAGATTCTGAAGATTCTGAGTGGAGTTCGATGAGCGAGCAGCTCCAAACAAAACTAAAATAATTAAATCTGCGTTGGACCAATGTAATGCAGTTTTCTAGAGGTTTCCTAGGTTTCCTAATATCTTTGTCGCCATGTCGCCATATCGGAAGAGAACTTAT

Full Affymetrix probeset data:

Annotations for 1641303_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime