FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641305_at:

>probe:Drosophila_2:1641305_at:355:215; Interrogation_Position=2482; Antisense; AAGATGTGCCACTTGTACTACAATT
>probe:Drosophila_2:1641305_at:694:489; Interrogation_Position=2496; Antisense; GTACTACAATTGGTCGGGCACCACA
>probe:Drosophila_2:1641305_at:610:155; Interrogation_Position=2518; Antisense; ACACGAGTGCCAGCAGTTTGCCAGT
>probe:Drosophila_2:1641305_at:39:93; Interrogation_Position=2532; Antisense; AGTTTGCCAGTACGCTAAGAAGCTA
>probe:Drosophila_2:1641305_at:155:655; Interrogation_Position=2547; Antisense; TAAGAAGCTAGCTACCCTCGTGGGT
>probe:Drosophila_2:1641305_at:370:639; Interrogation_Position=2564; Antisense; TCGTGGGTACGAACTTGCACTCTAT
>probe:Drosophila_2:1641305_at:524:383; Interrogation_Position=2574; Antisense; GAACTTGCACTCTATTCCGCAAAAC
>probe:Drosophila_2:1641305_at:491:389; Interrogation_Position=2679; Antisense; GAAACTAGCCCAGACATTTATACTT
>probe:Drosophila_2:1641305_at:8:31; Interrogation_Position=2709; Antisense; ATACTTTCTTACTTTTGCTAAGCAC
>probe:Drosophila_2:1641305_at:380:53; Interrogation_Position=2768; Antisense; ATGCATTACTGCTCTTTTTTCAAAC
>probe:Drosophila_2:1641305_at:80:151; Interrogation_Position=2955; Antisense; ACATCCATGTTTGCTTACTTAACCA
>probe:Drosophila_2:1641305_at:513:149; Interrogation_Position=2971; Antisense; ACTTAACCACACATTCATGGCTGCT
>probe:Drosophila_2:1641305_at:289:269; Interrogation_Position=2986; Antisense; CATGGCTGCTTATATTCGTGAAACA
>probe:Drosophila_2:1641305_at:370:29; Interrogation_Position=3024; Antisense; ATACAGGTATTTAACTTTCACAAGG

Paste this into a BLAST search page for me
AAGATGTGCCACTTGTACTACAATTGTACTACAATTGGTCGGGCACCACAACACGAGTGCCAGCAGTTTGCCAGTAGTTTGCCAGTACGCTAAGAAGCTATAAGAAGCTAGCTACCCTCGTGGGTTCGTGGGTACGAACTTGCACTCTATGAACTTGCACTCTATTCCGCAAAACGAAACTAGCCCAGACATTTATACTTATACTTTCTTACTTTTGCTAAGCACATGCATTACTGCTCTTTTTTCAAACACATCCATGTTTGCTTACTTAACCAACTTAACCACACATTCATGGCTGCTCATGGCTGCTTATATTCGTGAAACAATACAGGTATTTAACTTTCACAAGG

Full Affymetrix probeset data:

Annotations for 1641305_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720