Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641306_at:

>probe:Drosophila_2:1641306_at:351:159; Interrogation_Position=1981; Antisense; ACAATCTTCGTGTCCAAAGTGGCAG
>probe:Drosophila_2:1641306_at:711:105; Interrogation_Position=2004; Antisense; AGACACCAGTTTCGATTTGCCCGAG
>probe:Drosophila_2:1641306_at:182:693; Interrogation_Position=2019; Antisense; TTTGCCCGAGGCTAATGTGCTTATC
>probe:Drosophila_2:1641306_at:609:229; Interrogation_Position=2032; Antisense; AATGTGCTTATCCAGATCTCTTCGC
>probe:Drosophila_2:1641306_at:521:499; Interrogation_Position=2087; Antisense; GTCTGGGTCGTATTCTGCGTGCTAA
>probe:Drosophila_2:1641306_at:227:565; Interrogation_Position=2130; Antisense; GGAATACAACGCCTTCTTCTATACA
>probe:Drosophila_2:1641306_at:218:713; Interrogation_Position=2146; Antisense; TTCTATACACTCGTCTCGCAGGATA
>probe:Drosophila_2:1641306_at:207:275; Interrogation_Position=2208; Antisense; CTTGGTCAACCAGGGCTATAGCTAC
>probe:Drosophila_2:1641306_at:451:665; Interrogation_Position=2230; Antisense; TACAAGGTTATCACGCATCTCAAGG
>probe:Drosophila_2:1641306_at:413:405; Interrogation_Position=2266; Antisense; GACTCGGATTTGATGTACGGCACAC
>probe:Drosophila_2:1641306_at:648:45; Interrogation_Position=2325; Antisense; ATCCGCTTCCGATTTGGACTGCGAG
>probe:Drosophila_2:1641306_at:607:143; Interrogation_Position=2421; Antisense; ACTGAGCTCCATGTCTGGCGGAGAT
>probe:Drosophila_2:1641306_at:403:211; Interrogation_Position=2473; Antisense; AAGAACATTGGCAGCGTGCATCCGC
>probe:Drosophila_2:1641306_at:703:507; Interrogation_Position=2488; Antisense; GTGCATCCGCTCTTCAAAAAATTCA

Paste this into a BLAST search page for me
ACAATCTTCGTGTCCAAAGTGGCAGAGACACCAGTTTCGATTTGCCCGAGTTTGCCCGAGGCTAATGTGCTTATCAATGTGCTTATCCAGATCTCTTCGCGTCTGGGTCGTATTCTGCGTGCTAAGGAATACAACGCCTTCTTCTATACATTCTATACACTCGTCTCGCAGGATACTTGGTCAACCAGGGCTATAGCTACTACAAGGTTATCACGCATCTCAAGGGACTCGGATTTGATGTACGGCACACATCCGCTTCCGATTTGGACTGCGAGACTGAGCTCCATGTCTGGCGGAGATAAGAACATTGGCAGCGTGCATCCGCGTGCATCCGCTCTTCAAAAAATTCA

Full Affymetrix probeset data:

Annotations for 1641306_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime