FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641307_at:

>probe:Drosophila_2:1641307_at:652:125; Interrogation_Position=164; Antisense; ACCACGACGACTCCGAAGCCTAAAG
>probe:Drosophila_2:1641307_at:228:379; Interrogation_Position=178; Antisense; GAAGCCTAAAGAGTCGTCTACAACC
>probe:Drosophila_2:1641307_at:241:285; Interrogation_Position=191; Antisense; TCGTCTACAACCACTACGACTACGA
>probe:Drosophila_2:1641307_at:489:387; Interrogation_Position=227; Antisense; GAAAAGCCCAAGTCAGAGTCCACAA
>probe:Drosophila_2:1641307_at:568:249; Interrogation_Position=249; Antisense; CAACTGCCAGTACGACTACCACAAG
>probe:Drosophila_2:1641307_at:36:129; Interrogation_Position=371; Antisense; ACCACTCCAAAGCCCGATGATGATG
>probe:Drosophila_2:1641307_at:513:119; Interrogation_Position=405; Antisense; AGCTGCTGCAACAATGTGCCGAGTT
>probe:Drosophila_2:1641307_at:173:231; Interrogation_Position=417; Antisense; AATGTGCCGAGTTGAGCCGCCGGAA
>probe:Drosophila_2:1641307_at:673:531; Interrogation_Position=449; Antisense; GGTGGATCTTCCTCGTCCGAAGAGG
>probe:Drosophila_2:1641307_at:195:401; Interrogation_Position=476; Antisense; GACAGTGGCGAGAAGAAATCGGCAA
>probe:Drosophila_2:1641307_at:474:421; Interrogation_Position=566; Antisense; GAGAAGGCCCAGAAATCGGCACTAT
>probe:Drosophila_2:1641307_at:118:107; Interrogation_Position=576; Antisense; AGAAATCGGCACTATCGGAACTGGC
>probe:Drosophila_2:1641307_at:98:287; Interrogation_Position=596; Antisense; CTGGCCGAGGCCTTGAAAAACTACA
>probe:Drosophila_2:1641307_at:641:375; Interrogation_Position=634; Antisense; GAACTAATGTGCCAATAAATCTTTT

Paste this into a BLAST search page for me
ACCACGACGACTCCGAAGCCTAAAGGAAGCCTAAAGAGTCGTCTACAACCTCGTCTACAACCACTACGACTACGAGAAAAGCCCAAGTCAGAGTCCACAACAACTGCCAGTACGACTACCACAAGACCACTCCAAAGCCCGATGATGATGAGCTGCTGCAACAATGTGCCGAGTTAATGTGCCGAGTTGAGCCGCCGGAAGGTGGATCTTCCTCGTCCGAAGAGGGACAGTGGCGAGAAGAAATCGGCAAGAGAAGGCCCAGAAATCGGCACTATAGAAATCGGCACTATCGGAACTGGCCTGGCCGAGGCCTTGAAAAACTACAGAACTAATGTGCCAATAAATCTTTT

Full Affymetrix probeset data:

Annotations for 1641307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720