FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641310_at:

>probe:Drosophila_2:1641310_at:560:77; Interrogation_Position=4149; Antisense; AGGTCATCGCTGTGGGTTTTCCGGA
>probe:Drosophila_2:1641310_at:198:701; Interrogation_Position=4165; Antisense; TTTTCCGGAGCTTATTGGCCTCTTA
>probe:Drosophila_2:1641310_at:163:571; Interrogation_Position=4180; Antisense; TGGCCTCTTAGCTTAATCAAACGAC
>probe:Drosophila_2:1641310_at:429:475; Interrogation_Position=4228; Antisense; GTTATATACGCTCCGCATTTGGCAA
>probe:Drosophila_2:1641310_at:70:727; Interrogation_Position=4278; Antisense; TTGATTTCTCCATTCGACGATAGCA
>probe:Drosophila_2:1641310_at:55:353; Interrogation_Position=4300; Antisense; GCAGCAATTTGTATGTATCTTTCTT
>probe:Drosophila_2:1641310_at:585:23; Interrogation_Position=4400; Antisense; ATATGCCAGTTCGTATTTCGCTTTC
>probe:Drosophila_2:1641310_at:420:695; Interrogation_Position=4415; Antisense; TTTCGCTTTCTACCAGAGAGACACC
>probe:Drosophila_2:1641310_at:456:311; Interrogation_Position=4440; Antisense; GCCAAGCGGCTTCTGTTTAAGCAAT
>probe:Drosophila_2:1641310_at:233:235; Interrogation_Position=4479; Antisense; AATCCACACAACCACTATGTTATCC
>probe:Drosophila_2:1641310_at:51:149; Interrogation_Position=4492; Antisense; ACTATGTTATCCTTACTTTTGTGTA
>probe:Drosophila_2:1641310_at:567:243; Interrogation_Position=4530; Antisense; AATTGTTTATACTCACAACGCCCCA
>probe:Drosophila_2:1641310_at:301:357; Interrogation_Position=4558; Antisense; GCAAACCTATCTATACAGACGCGAA
>probe:Drosophila_2:1641310_at:331:133; Interrogation_Position=4576; Antisense; ACGCGAACCGCAAGAGAACAGAGAT

Paste this into a BLAST search page for me
AGGTCATCGCTGTGGGTTTTCCGGATTTTCCGGAGCTTATTGGCCTCTTATGGCCTCTTAGCTTAATCAAACGACGTTATATACGCTCCGCATTTGGCAATTGATTTCTCCATTCGACGATAGCAGCAGCAATTTGTATGTATCTTTCTTATATGCCAGTTCGTATTTCGCTTTCTTTCGCTTTCTACCAGAGAGACACCGCCAAGCGGCTTCTGTTTAAGCAATAATCCACACAACCACTATGTTATCCACTATGTTATCCTTACTTTTGTGTAAATTGTTTATACTCACAACGCCCCAGCAAACCTATCTATACAGACGCGAAACGCGAACCGCAAGAGAACAGAGAT

Full Affymetrix probeset data:

Annotations for 1641310_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720