FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641311_at:

>probe:Drosophila_2:1641311_at:447:433; Interrogation_Position=333; Antisense; GAGGATCAAAATGCCCGCCAAAAGT
>probe:Drosophila_2:1641311_at:563:211; Interrogation_Position=443; Antisense; AAGAAACCTCTAACAGCGATCCAAG
>probe:Drosophila_2:1641311_at:31:159; Interrogation_Position=520; Antisense; ACAACACTCCAAGCTCTGGCAGAAA
>probe:Drosophila_2:1641311_at:594:565; Interrogation_Position=537; Antisense; GGCAGAAAATCTCGCTCTTCGGAGT
>probe:Drosophila_2:1641311_at:33:551; Interrogation_Position=557; Antisense; GGAGTCCTGCCGATGATAGCCATTC
>probe:Drosophila_2:1641311_at:449:27; Interrogation_Position=572; Antisense; ATAGCCATTCTCACCCTTTTGGTTT
>probe:Drosophila_2:1641311_at:326:677; Interrogation_Position=589; Antisense; TTTGGTTTTTAGCACTCGATCGGAA
>probe:Drosophila_2:1641311_at:4:191; Interrogation_Position=635; Antisense; AACTATGAGCATATGTACCGGCGGA
>probe:Drosophila_2:1641311_at:591:301; Interrogation_Position=652; Antisense; CCGGCGGACGAAGCGATACTGGTTT
>probe:Drosophila_2:1641311_at:150:439; Interrogation_Position=680; Antisense; GATGGAAACCGTACCGCTTTTCACA
>probe:Drosophila_2:1641311_at:621:487; Interrogation_Position=690; Antisense; GTACCGCTTTTCACAATAGTCACTT
>probe:Drosophila_2:1641311_at:510:89; Interrogation_Position=707; Antisense; AGTCACTTTAATGCTTTGCCTCCAG
>probe:Drosophila_2:1641311_at:6:363; Interrogation_Position=832; Antisense; GAATTGGCGCAAACACTCGTCTAAA
>probe:Drosophila_2:1641311_at:348:639; Interrogation_Position=848; Antisense; TCGTCTAAAAGGGATGCGCAGCTCA

Paste this into a BLAST search page for me
GAGGATCAAAATGCCCGCCAAAAGTAAGAAACCTCTAACAGCGATCCAAGACAACACTCCAAGCTCTGGCAGAAAGGCAGAAAATCTCGCTCTTCGGAGTGGAGTCCTGCCGATGATAGCCATTCATAGCCATTCTCACCCTTTTGGTTTTTTGGTTTTTAGCACTCGATCGGAAAACTATGAGCATATGTACCGGCGGACCGGCGGACGAAGCGATACTGGTTTGATGGAAACCGTACCGCTTTTCACAGTACCGCTTTTCACAATAGTCACTTAGTCACTTTAATGCTTTGCCTCCAGGAATTGGCGCAAACACTCGTCTAAATCGTCTAAAAGGGATGCGCAGCTCA

Full Affymetrix probeset data:

Annotations for 1641311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720