Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641312_at:

>probe:Drosophila_2:1641312_at:174:453; Interrogation_Position=3134; Antisense; GATCTGCGGTGCGAGCTGCCCAAGC
>probe:Drosophila_2:1641312_at:202:205; Interrogation_Position=3164; Antisense; AAGCGTCTACGCTGTACCATGGAGC
>probe:Drosophila_2:1641312_at:176:393; Interrogation_Position=3193; Antisense; GAAAGCTCTGGAGACAGCGCTCAAG
>probe:Drosophila_2:1641312_at:557:543; Interrogation_Position=3241; Antisense; GGATCGCAAGCGCTACCAATACGAG
>probe:Drosophila_2:1641312_at:439:207; Interrogation_Position=3296; Antisense; AAGCATCTGGGCAGACGTGGCCCAC
>probe:Drosophila_2:1641312_at:524:103; Interrogation_Position=3308; Antisense; AGACGTGGCCCACAGGCACAGATCG
>probe:Drosophila_2:1641312_at:115:535; Interrogation_Position=3345; Antisense; GGTCCGGCCAGGGTGCAATCGCCAT
>probe:Drosophila_2:1641312_at:553:615; Interrogation_Position=3358; Antisense; TGCAATCGCCATTCGTGGTGGTGGC
>probe:Drosophila_2:1641312_at:157:573; Interrogation_Position=3379; Antisense; TGGCGCCGTTGGAGGACCATCCCCG
>probe:Drosophila_2:1641312_at:724:331; Interrogation_Position=3403; Antisense; GCTGGCCCAGGTTAATCCTGTCAAC
>probe:Drosophila_2:1641312_at:19:631; Interrogation_Position=3418; Antisense; TCCTGTCAACTCGTAGATCCAATCA
>probe:Drosophila_2:1641312_at:318:471; Interrogation_Position=3460; Antisense; GTTCAGCTCCGCTTTAAACTAAACT
>probe:Drosophila_2:1641312_at:242:31; Interrogation_Position=3512; Antisense; ATAACTGATAATTGCCTTCGCTTAG
>probe:Drosophila_2:1641312_at:428:307; Interrogation_Position=3526; Antisense; CCTTCGCTTAGATGAGATGTGTCGC

Paste this into a BLAST search page for me
GATCTGCGGTGCGAGCTGCCCAAGCAAGCGTCTACGCTGTACCATGGAGCGAAAGCTCTGGAGACAGCGCTCAAGGGATCGCAAGCGCTACCAATACGAGAAGCATCTGGGCAGACGTGGCCCACAGACGTGGCCCACAGGCACAGATCGGGTCCGGCCAGGGTGCAATCGCCATTGCAATCGCCATTCGTGGTGGTGGCTGGCGCCGTTGGAGGACCATCCCCGGCTGGCCCAGGTTAATCCTGTCAACTCCTGTCAACTCGTAGATCCAATCAGTTCAGCTCCGCTTTAAACTAAACTATAACTGATAATTGCCTTCGCTTAGCCTTCGCTTAGATGAGATGTGTCGC

Full Affymetrix probeset data:

Annotations for 1641312_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime