FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641314_at:

>probe:Drosophila_2:1641314_at:35:319; Interrogation_Position=1060; Antisense; GCCGTGTTGCCACATCAAAGTCATC
>probe:Drosophila_2:1641314_at:434:651; Interrogation_Position=1074; Antisense; TCAAAGTCATCGATCGTCCGCCTGG
>probe:Drosophila_2:1641314_at:517:67; Interrogation_Position=1108; Antisense; ATGGCCGCCAATCGCTTTTTTAACA
>probe:Drosophila_2:1641314_at:66:307; Interrogation_Position=1154; Antisense; CCTCGCTTAATCTGGGCAGGCACAG
>probe:Drosophila_2:1641314_at:280:115; Interrogation_Position=1177; Antisense; AGCAGGGATTTGCTGGCCACCACCA
>probe:Drosophila_2:1641314_at:98:157; Interrogation_Position=1247; Antisense; ACAGCCATGGCCACAGCAACAGTTC
>probe:Drosophila_2:1641314_at:482:187; Interrogation_Position=1321; Antisense; AACACACCATCCACGGGACGATCTA
>probe:Drosophila_2:1641314_at:640:555; Interrogation_Position=1336; Antisense; GGACGATCTATCTCGGCGGCAGTTC
>probe:Drosophila_2:1641314_at:283:713; Interrogation_Position=1358; Antisense; TTCATCATCCGCGAACCGAATTTGC
>probe:Drosophila_2:1641314_at:624:667; Interrogation_Position=1399; Antisense; TACATACCCTACAGTGCCTCGAAAT
>probe:Drosophila_2:1641314_at:253:507; Interrogation_Position=1412; Antisense; GTGCCTCGAAATTCAAAGCCTTCAA
>probe:Drosophila_2:1641314_at:47:205; Interrogation_Position=1427; Antisense; AAGCCTTCAAGTAACCTCAAACAAT
>probe:Drosophila_2:1641314_at:66:275; Interrogation_Position=939; Antisense; CATTCTCAATGTGCTCGATACCAAC
>probe:Drosophila_2:1641314_at:585:529; Interrogation_Position=975; Antisense; GGGATTGCTCAACAACCGCAGCTTC

Paste this into a BLAST search page for me
GCCGTGTTGCCACATCAAAGTCATCTCAAAGTCATCGATCGTCCGCCTGGATGGCCGCCAATCGCTTTTTTAACACCTCGCTTAATCTGGGCAGGCACAGAGCAGGGATTTGCTGGCCACCACCAACAGCCATGGCCACAGCAACAGTTCAACACACCATCCACGGGACGATCTAGGACGATCTATCTCGGCGGCAGTTCTTCATCATCCGCGAACCGAATTTGCTACATACCCTACAGTGCCTCGAAATGTGCCTCGAAATTCAAAGCCTTCAAAAGCCTTCAAGTAACCTCAAACAATCATTCTCAATGTGCTCGATACCAACGGGATTGCTCAACAACCGCAGCTTC

Full Affymetrix probeset data:

Annotations for 1641314_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720