FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641315_at:

>probe:Drosophila_2:1641315_at:15:489; Interrogation_Position=267; Antisense; GTACCCGTCAAAGGCAGGATTTTCT
>probe:Drosophila_2:1641315_at:570:77; Interrogation_Position=282; Antisense; AGGATTTTCTGCCTTGGCCAACAAG
>probe:Drosophila_2:1641315_at:602:445; Interrogation_Position=306; Antisense; GATGCCACGATTACCAATCTTTCGA
>probe:Drosophila_2:1641315_at:505:687; Interrogation_Position=348; Antisense; TATTGGATCCTACGCTACCGATTTT
>probe:Drosophila_2:1641315_at:683:105; Interrogation_Position=488; Antisense; AGACAGCTTTCGGATCCAAGCGCAT
>probe:Drosophila_2:1641315_at:82:207; Interrogation_Position=505; Antisense; AAGCGCATCATCTGGCCAGCAGTGG
>probe:Drosophila_2:1641315_at:494:115; Interrogation_Position=522; Antisense; AGCAGTGGCCGTATTTTGCAGTCCC
>probe:Drosophila_2:1641315_at:705:231; Interrogation_Position=613; Antisense; AATGACGCGGACATGTGCCGACAAT
>probe:Drosophila_2:1641315_at:432:53; Interrogation_Position=640; Antisense; ATGCATGTCGAGATGGCGGCGATCA
>probe:Drosophila_2:1641315_at:686:241; Interrogation_Position=672; Antisense; CAATCTTCAGGTGACGGAGCGGTAT
>probe:Drosophila_2:1641315_at:36:159; Interrogation_Position=710; Antisense; AAATCAAGCAATTCGTACCGGCCAG
>probe:Drosophila_2:1641315_at:279:97; Interrogation_Position=733; Antisense; AGATACTGCGGATTCTTCCACGATC
>probe:Drosophila_2:1641315_at:330:147; Interrogation_Position=766; Antisense; ACTACGGCCACAATTGAACGGGATT
>probe:Drosophila_2:1641315_at:674:161; Interrogation_Position=825; Antisense; AAATTACTTGTATCGGCTGAATGCA

Paste this into a BLAST search page for me
GTACCCGTCAAAGGCAGGATTTTCTAGGATTTTCTGCCTTGGCCAACAAGGATGCCACGATTACCAATCTTTCGATATTGGATCCTACGCTACCGATTTTAGACAGCTTTCGGATCCAAGCGCATAAGCGCATCATCTGGCCAGCAGTGGAGCAGTGGCCGTATTTTGCAGTCCCAATGACGCGGACATGTGCCGACAATATGCATGTCGAGATGGCGGCGATCACAATCTTCAGGTGACGGAGCGGTATAAATCAAGCAATTCGTACCGGCCAGAGATACTGCGGATTCTTCCACGATCACTACGGCCACAATTGAACGGGATTAAATTACTTGTATCGGCTGAATGCA

Full Affymetrix probeset data:

Annotations for 1641315_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720