Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641316_at:

>probe:Drosophila_2:1641316_at:554:267; Interrogation_Position=1750; Antisense; CATGGCGAACGGTCGATTTTCAAGT
>probe:Drosophila_2:1641316_at:361:389; Interrogation_Position=1775; Antisense; GAAACAACAATGCTTCTGCTCCGTG
>probe:Drosophila_2:1641316_at:568:429; Interrogation_Position=1835; Antisense; GAGTTAGCTCTGGTGGATCTGCTCT
>probe:Drosophila_2:1641316_at:178:193; Interrogation_Position=1869; Antisense; AACTATTGCTACTCGGTATGCCGCA
>probe:Drosophila_2:1641316_at:584:663; Interrogation_Position=1911; Antisense; TAAAGCGCTGCATGCACGACATTCA
>probe:Drosophila_2:1641316_at:712:401; Interrogation_Position=1928; Antisense; GACATTCACATCAACGGCGGTCTAT
>probe:Drosophila_2:1641316_at:142:1; Interrogation_Position=1965; Antisense; AAACGGATTTCGTGTTCGTTCGCTG
>probe:Drosophila_2:1641316_at:617:625; Interrogation_Position=1988; Antisense; TGCCTGTTGGCCGTCAATCAGAATG
>probe:Drosophila_2:1641316_at:110:235; Interrogation_Position=2043; Antisense; AATCGCAAGTAATCCTCCAGCGTGC
>probe:Drosophila_2:1641316_at:315:263; Interrogation_Position=2060; Antisense; CAGCGTGCAGCTCAATCATTCAAGA
>probe:Drosophila_2:1641316_at:81:391; Interrogation_Position=2083; Antisense; GAAACTCTCCGCACATGCGAAGGTT
>probe:Drosophila_2:1641316_at:490:139; Interrogation_Position=2118; Antisense; ACGTGTTCTTGGCACAGCGATTTAA
>probe:Drosophila_2:1641316_at:126:587; Interrogation_Position=2179; Antisense; TGGAGAGTTCCGACGCTACTTTACG
>probe:Drosophila_2:1641316_at:304:671; Interrogation_Position=2225; Antisense; TATCTGGGTAGTCCTTAGTTTCCGT

Paste this into a BLAST search page for me
CATGGCGAACGGTCGATTTTCAAGTGAAACAACAATGCTTCTGCTCCGTGGAGTTAGCTCTGGTGGATCTGCTCTAACTATTGCTACTCGGTATGCCGCATAAAGCGCTGCATGCACGACATTCAGACATTCACATCAACGGCGGTCTATAAACGGATTTCGTGTTCGTTCGCTGTGCCTGTTGGCCGTCAATCAGAATGAATCGCAAGTAATCCTCCAGCGTGCCAGCGTGCAGCTCAATCATTCAAGAGAAACTCTCCGCACATGCGAAGGTTACGTGTTCTTGGCACAGCGATTTAATGGAGAGTTCCGACGCTACTTTACGTATCTGGGTAGTCCTTAGTTTCCGT

Full Affymetrix probeset data:

Annotations for 1641316_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime